Gene detail

Detailed information of OS493_026193-T1 in Lophelia pertusa

Genomic Location: scaffold_133:876400...899100
NR annotation: KAJ7390317.1, U2 snRNP-associated SURP domain-containing protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026193-T1

ATGGCGGCGAAGAAGTCAGAATCTGACAAAAATCTTCCTTGGGGCTTATCCCCAGAGGGGTTAGCCCCCGGATCTATGAAGACAATTTCGCAGAGCAAGTTGAAGTCATTTTCCATCGGTATGATGAACGCTGGACTGAAGAAGCCCTCTAAATCAAAGCACGAATCTGATGAGAAGAAAAAGAAGGCAGAATCAGAATGCGCAGAAGTGTTTGCAGATTTTGTGGCTTCATTTGAAGATTCCCGTGTAGGTGGTAAAGCCTTTGTACGCGGTAACACAATCAACCCAGAAACCAAAGAGGAAACTGCTTCAGCGCAGGCCGGAGCATTATACAAGCCAATGGCAACACTGTCTGCTACTATTATGGAACAGAAAATCAAGACTGAACTGGTTCAACCTAAGCTGGAATTGAAGAAAAAAGTCAAGGACAAAGAAAAGAAGAAGAGCAATTTAGAACTCTTTAAAGAAGAATTAAAAAGACAGCAGAAGGAACGGGAGATTAGGCACAAGATCAAGTCAGGGGATTTAGCAGATATTCCGAAAGATGTTCTTGAAAATATGGCACCCTCTCTTCTCAATCCGTCGAAGGAGGATAGTTATTCTTACGGGTCACATGATACTGGAGATCCTGGTACGACAAACCTGTACATTGGGAATATCAATCCAACAATGACTGAGGAGATGTTAATGCGGCTCTTCGGCAAGTATGGACCCCTGGCGAGTGTGAAAATAATGTGGCCCAGGACGGATGAGGAGAAAGCTCGGAACAGGAACTGTGGTTTTGTTGCCTACATGAGAAGAAAGGATGGGGAAAAAGCTCTGACTGCACTAAAAGGGAAAGAAGTCATGTCATATGAGATGAAACTAGGATGGGGCAAAGGTGTTCCCATACCACCCCACCCTATTTACATTCCCCCTGAGATGCAGGAGGACACCACACCACCTCCCCCGTCAGGCTTGCCATTCAATGCCCAACCTGATAAAAAGAAAGATGACTATTCCAGTGCCCCTCCCCCACAGGGAGGGGGCGAGGAAGGCACACGTGATCTTGATGTCAACGGTTTTAATAAAGAGGTGAGGACTCTGCTGTGTCTCGTTCACCGTATGGTTGAGTTTGTGGTGCGCGAGGGACCCATGTTTGAGGCTATGATTATGAACAAGGAACTGAATAACCCAATGTATCGGTTCTTGTTTGATAACCAGAGTCCAGAACACATCTATTACCGGTGGAAACTGTTTTCCATTCTCCAGGGTGATTCCCCAACAAAGTGGCGAACAGAAAGATTTAAGATGTTTGAAAATGGCTCTGTGTGGAAACCTCCTCAGTGCCATCAGTACACCATGAGTGCCGCAGCTTTTAATGCCAATAAACAACCTGTACCTCAAGTAGAAACACCTCTAGCACCACCGTCACAGGCAGCGACAACAGCAACCGAACCTCCTTCACACAGCTCAAGCAGCAGTAACAGCAGCAGCACCATGCCAACATCCACTGCAGCAAGTAGCAGAAGGCTTCTCTGTCCAACAGACTGTCCTGTGAGGGTGTGCAAGCAACGCGACAAGCTGGAAGATATGTTGAGGGATTTAACACCAGAAAGAGCAAAAATTGCCAGGTGTATGGTGTTCTGTGTTAATCATGCCGACTGTGCTGAGGAGGTTGTTGAATGCATTGCCGAGTCGTTGACGATTTTAGAAACGCCCTTACTGGTCAAGGTTGCACGGTTGTATCTGGTATCTGACATTCTGCACAACTGCTCTGTCAAAGTGCCAAATGTGTCGTACTACAGAAAAGGGTTTCAGACCCTACTCCCAGACATCTTTGGTAACCTTAGTGCTTCATTCAAAGCCATAAATGCCCGCATGAAAGCTGAGAACTTTAGGGTTGTAGAGCCACCCTCCAAGTCACTTTATCCACTAGACGGTAGCTTCAGTCGAAACAAGGATGATCTAGATGGAGCCCCTCTGGACATTGATGGTGTACTAATAAAAGCAAAGGACATGGATGGAGTGCCCTTAAAACAGGTCGATCTTGATGGGGTTCCATTGACTGGTGATGATATCGATGGAATGCCAATGGACAGTAAAAAGACGCCTGACAAGTCACGTGACAAAGATGTTCCTCACGTTGCGTCAAAATGGGATCGTCCCGATTGGGAGAGAATTGAAGAGCGTGAGCCTTCACCAAAAACTCCCGTCAAAGAAGATTCTCCGAACAGACCCGAAGAGCAGGCGGCTGTTTCCGTAGAAACCCCGCGAATCACGGAAATTGACGAAAGCAGGCGAAGAAAGCTTCGGGAAATCGAACTAAAAGTTGCAGAGTACGCTCAGAAACTGGAAGCAAAGGGGACGAGTAACATCGCTCAACAGTGTGATGTGTACAGAGCCAAGTTACTTGAGGCTATTGAACCAAAAGAAACAAAAGAGAAAAAGAAGAAAGGAAATAGCCACACCAACTCTCCCTCGGAATCCCGCCGAAAGAAGTCTCGCAGTCGTTCCAAGTCCCCGCCGTCCAAAAAGCGTACTCGACGGGCCCAGTCCTCTGAAAGCCGCTCGGCTTCGAGATCTCCCGCGCGGAGCAGGTCACGGTCGCCATTGACAACGTCACTACAGTCCTTGAAGCATTACGAGTCACGCACACCCTCGCCTTCAAATTCAAGACGGTCACGGTCCCGCAGCCGGAGTTCATCCCGCGGGCGCGGAAGATCACGGTCCCGAAGTCGCTCACCGAGTGGCGGCAAACAGAGGCGTAAACGCTCCAGGTCACGCAGCGGAACACCCGTCAAGAAAAGCTCGTCCCGAAAGAAGCGCTCAAGATCCCGCTCGAGATCGCCGGCCAGAAAAAAGAGTAAAAAGAAGAAGAAGTAA

Transcript

OS493_026193-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5R7X2	U2 snRNP-associated SURP motif-containing protein OS=Pongo abelii OX=9601 GN=U2SURP PE=2 SV=1
O15042	U2 snRNP-associated SURP motif-containing protein OS=Homo sapiens OX=9606 GN=U2SURP PE=1 SV=2
Q6NV83	U2 snRNP-associated SURP motif-containing protein OS=Mus musculus OX=10090 GN=U2surp PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003564 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08312 all species →	cwf21	cwf21 domain	Domain	Interproscan
PF01805 all species →	Surp	Surp module	Family	Interproscan
PF04818 all species →	CID	CID domain	Repeat	Interproscan
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000061 all species →	Domain	SWAP/Surp	Interproscan
IPR013170 all species →	Domain	mRNA splicing factor Cwf21 domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR006569 all species →	Domain	CID domain	Interproscan
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR035967 all species →	Homologous_superfamily	SWAP/Surp superfamily	Interproscan
IPR008942 all species →	Homologous_superfamily	ENTH/VHS	Interproscan
IPR051485 all species →	Family	SR-related and CTD-associated factor	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR047488 all species →	Domain	U2-associated protein SR140, cwf21 domain	Interproscan
IPR035009 all species →	Domain	SR140, RNA recognition motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23140 all species →	RNA PROCESSING PROTEIN LD23810P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12842	SR140; U2-associated protein SR140	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026193-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

248.0Max TPM

126.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	143.23	197.55
polyp at pH7 6	18	18	145.22	212.68
coral polyp · control treatment	16	16	132.77	248.00
coral polyp · oil and dispersant treatment	16	16	96.05	149.14
coral polyp · oil treatment	16	16	138.12	186.74
coral polyp · dispersant treatment	16	16	93.30	143.39
Polyp	10	10	137.85	225.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	197.55
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	190.26
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	182.84
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	172.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	150.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	150.03
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	147.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	146.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	143.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	143.01
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	142.41
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	141.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	122.04
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	120.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	113.49
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.46
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.81
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	212.68
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	212.57
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	208.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	198.89
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	196.97
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	195.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	160.16
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	157.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	155.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	154.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	130.96
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	129.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	103.01
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	102.57
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	79.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.88
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.27
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	248.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	196.10
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	173.57
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	172.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	142.50
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	140.91
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	126.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	126.41
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	120.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	114.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	112.52
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.98
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.84
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.81
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	82.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	81.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	149.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	147.97
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	131.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	114.25
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	113.93
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	111.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.80
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.33
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.91
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.39
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.66
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.19
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.54
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.29
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	186.74
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	183.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	172.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	171.66
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	168.29
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	168.16
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	166.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	130.49
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	115.17
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	115.15
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	114.40
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	112.66
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	106.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.46
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.38
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	97.80
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	143.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	126.01
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	119.85
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	115.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	112.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	102.56
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	101.35
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	98.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	97.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.79
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.47
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.05
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.27
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.04
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.19
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	225.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	182.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	171.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	133.13
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	123.11
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	121.43
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	119.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	111.37
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	109.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	81.71

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.