Gene detail

Detailed information of OS493_026225-T1 in Lophelia pertusa

Genomic Location: scaffold_134:153211...178783
NR annotation: KAJ7383695.1, hypothetical protein OS493_026225 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026225-T1

ATGAGTGCGTCGCCGGAGACCAACGTGCCTCCGAGCGCGGATTCGAATGGAAACAATTTAAAGCAAGGCAGCTTGTTGTTGAGTATTTATGGGTACGCTTCTTATCCCGCTCCCGACTCTTCGTCAACTGAGTTGAAAAAACAAGTTCTTGGAAGATCCAACAGCCTTGGAATTATCGAGAACATCAAGAAAAAGTCGTTCCAACCTTCGTTTCTCGCCGGAGCTGAAACACATCACGATGCGTCGAAACGTAACAGCTGCTTCGAGATAAGGGACTACGAGATGCCGAAGAGAACGACATCAAGCGCGGATCGCGAGAGGAAGACATCCTCTCGCTTGTTTCGCTCTATGTCGTTGAGCGGGCGCAAACAGTCCAACAAAGAACAAGCTGCGAGCGACGATAAAAGGAATTCGACCATTTCAATTTCAGACACTGAAAAGTTGAAAGAAGCCGAGCGAGAGATTCAAAACTTGAAAGAATTGTTGAGCACACGGATTAAACAGGAATTCGATAATTGCGTGACAGAAGCCAACGATAAAAGAACTCGAATCTCTTTCAGTGACCTCGAGTTAGAATCTGTGGAATCGAAAGGTAACAATGTGATTTTTCCTTCCAAAGTTGAACATCTCGAAACCACTATTGAAGCTAATGCGGTTCCGCTTCAAAAGACTACTTCGTGTAAGGAGTGTGAACGGTTAAAGGAGTCGCGCATCAAAGCTGTCGTGGAAGCTATAGCTCTGAGAAAATACGTCAAAAATTTAAACGATGCGCTCTCCGGTGGTGAAGCGAGCAAGCAGAATTTTTTAAACGATGTGCAGAAGAAACTGGTCTCTGCACAAACAGAGAAGGAGGTCGCGTTAGAAGAACTTGCAACTGTTATTGATCAGCGGAATCAGGCGGTTCGAGAGAAGGACAAAGCGCTTGAGGAATGGGGCAAAGCAACGAGTAAATGGGAAAACACTTTGGATCAGTTAGATTCCCTTGTCAAAGAACTCGATAAGGTAAAATCAGAGCGCGATGATTTAACCAAGAAGCTCAAGCGAAAAGAAGACGCCCTAGAGAGAATAAAACAGGAGACATCGTTATTAAGTGAACAAATTGAAGTGACGAAACAGGAGCAAATTGACTCAATAGCAGATCAAGATGTTGTTTTAAGAGACAGATTCGGAAAGACAGAATCTGTACGAAAACTGAGCACTGAACTCACCAAATCACAACAGCGAAATATCGAAATGGACGCTCGAGTGACATCACTCGAAGAGAAAGCAGAGACTTATAAGAGAGAACGAGACCACGCGAAGGAACAATGGAGGCAATCGGTGAAGGAGAGAAAGAGACTACACCGCGAAATTGCCAGCATTGTGCAAGCCAGGGACGAAGCGATACAGAAATGTTTTTCAACCGCAGAACAGTTAGAGAAATTGAAAGAAGAGTACAATCACTTGTTGAACCGGTTGGCGAAAACCGGTTTGAGTGCGAATAACTCTAGTGAACTGTCAATTCCCTGCTCGCTCAAGGAGTGTAAATTCTGCGCGGGTGATTCAGCAGGAGGAATAGAGTCTCCAGACACGTCATTCACGGAAAGTGAAGAAATTCGAGTCAATTTAGAAAAGGACGATCCACTGGACTCCATCAAGTTGGCTCGAGTTTCTATGAGCGGCAGGGCGTTTACTGCCATCATAGATATCGACAAGGCTTTCGGCAGCTCTAGGAACATCAGAAAATATGATGAGATTGTGTCCATCAACGATATTCCAGTAACAGAGTCTGACCAAAACCTCGTGAAGTCTCTGCTGGATGGAGCTATTACCGCGCTCAGTATGATTCTCAAGCGACCAGTTGGAACATATCAGATCAGTTTTGACTTGGATCTCAAAGCTCCCAAGAAATCTAAAGCTGGTCTTGGTTTCGAGTGCGGGTTGTATGTGAAAGAACTGAAGCATGGATTTTTATCAGAGGATCAGAACAATCTGAAAATTGGAGATTACGTTATGAAGATCAATGGAAAACACCTTGATAAAATAATTGCTTCTTCGGTGGAGAAAGTTACCAAAAAGTCCGGCGACAAACTGAAACTTCACGTGACTAGAACGATCCTTGCCATGGCGAAAAGCTGCGAGTTAAAGCCGCTCAACAACACAGACTCCGAATCTGACACTGTCATACTGAGACGACTTCCGCGCTGTAACGGTGACAACCGCCTGTCACTCATATCAAATGACAGCTCGATATCACGTGACTCCAGATTTTCTTGCAACTCAAGCATGGGCTCTATGAGCTCGAACAATGATTCGTCTCTCGCCGACTCCAACTCGGATCTTTACGGAAACAAATTCACTGGCTATGGTCTCTACATACCCGACAGGCATCGAACGACAACGGCCATATACAGCCCCTCATCGGACTCTCAACTGGAGACTATCGTCGCAGATGATTGGCCAGACGCGAGGACTGGGAACGACTCCCAGAATACATCGGACGCTAAGGAAAGCGATACAAACGAGCACGGCACTTTGAAACCGAACTGTCGCTCGCCCATGAACCGGAAGTTCGTCAGCACGTCGCAATTGCAGTCGGGAACGTTTCTGACGCCAGTGGGTGTTGATGGGACATTGGTTCGTGCCCAGTCTACCATCACTGCTGTTCGAGTGGACGATGATGGATTGAACTCAGGTTTAATGAGATCATCCACGTGTGGAACAATTGTCCCCGCGGGGAGGAGTCCTCGTGTGATGCGCCTCGAGAAGAAGCCGCTGAACGGTCTGGGGCTAGAAGTTTCTGGCGGTTATCGCGTTGGTATTTACGTCATTGAGCTGCAGGACAACTCAGTTTGTAAGGCCGCTGGCCTTCAGGTTGGAGACAGGCTCTTAAAGCTCAACAGTTATGATCTGAGCCGAGCGACCCTGGATCACGCCACCAGGATTGTCCGCCTTCTAAGCACATGTACATATCTAAGAATTGAGGCACAGCAAGTGTCAAATTACCAAGAAATCCTTGAAGATAAACCTTACGATTCACTTTATGTCAGGACTATCCACGCATATAAGGCCATGGCCCCAGACGAGTTGAGTTTCACCATTGGAGAAACACTACACGTGATCAACACACGCGCAAACTACGATCAAGCGAGACAGAGTTGGAAGTGGGTGGCTCAGCGCGCGAGGAAAGATGGGAAGGTGCTAGAGGAAGGACTGGTGCCTTGTATGGGAAGTATTCCACAACATGTTGAGTCCACGGTACTATCCCAAACCCTTCAGCGGTTTGAATCCGAATCAGAGGAACAGATGAGCGATGACGCGCCGTGCACGCTGAAGAGAGCGTCAACAGAACGGCGCAGCATCATACAGAGATACCGGAAACTCATGAGACGTGAGAGCAGGGACTTCCCGAACAATATGGACGAAAATGGTAACACGAACAAGGTGACGTTTTACGAAATACTCAGCAAGATTTCCGACTGA

Transcript

OS493_026225-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002697 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR053004 all species →	Family	MAGUK Family Regulators of Signaling Pathways	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46360 all species →	DISKS LARGE HOMOLOG 5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0035331 all species →	Biological Process	negative regulation of hippo signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026225-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026225-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

15.5Max TPM

7.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.42	13.55
polyp at pH7 6	18	18	8.13	11.18
coral polyp · control treatment	16	16	7.84	11.48
coral polyp · oil and dispersant treatment	16	16	6.06	11.86
coral polyp · oil treatment	16	16	7.95	15.21
coral polyp · dispersant treatment	16	16	8.27	15.51
Polyp	10	10	4.69	7.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.55
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.09
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.09
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.62
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.88
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.43
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.86
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.18
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.43
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.93
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.60
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.55
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.95
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.54
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.73
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.49
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.34
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.89
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.68
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.53
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.50
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.73
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.86
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.88
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.52
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.04
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.70
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.71
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.77
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.34
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.06
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.03
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.21
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.85
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.78
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.73
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.07
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.53
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.89
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.09
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.07
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.34
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.39
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.96
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.05
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.48
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.31
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.86
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.66
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.52
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.39

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.