Gene detail

Detailed information of OS493_026359-T1 in Lophelia pertusa

Genomic Location: scaffold_135:386502...393660
NR annotation: KAJ7377792.1, hypothetical protein OS493_026359 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026359-T1

ATGAAGCAAGTTGATGAACCACCATTCGCTGCAGTTTCACTTGAAGATTTAACTGATTCACCTGGTGCAGACATAGTTCTAAGCGAGGAGCAGAGAGAATTTCTTGACGCCGTTCGTGACGGGCAAACTCGCGAGGTTCGTTCGTACGTCTTGGAGAAACATGTTGATGTAAACTGTGTCAACTTGTTGGGAGAAACCGCTCTGCAGTTAGCAGTGAACAACGATCGTCATGAGATCGCCAAGTTCCTCCTTGAAAACGGAGCCGAAGTGGGTACTGCGTTGCTGCAAGCCGTGGCAAAAGACTCGGTCGACTGGGTGAAGGCGTTACTCGATTTCGTGAAAGATACAGAAGCTTCCAGTCCAAGTCGTGCTTCTGTATCACAACAGACGAGCCAGGCTCAGTATAGTAAATTCCTTTCGCCTTTGGTGTTGGCTGCGCACAATGACAACCAAGAGATCGTAAATCTTTTGCTAGAGAAGGGCTACACAATTCAAGAGCCGCCGTTCCACAATCGATCTTGCGATTGTAGCGAATGTGAGCGGTTAGGGAAGCGATTGGGGAGTTCGCTTTATCGTTTGCACAGCTACCGAGCGCTGGCAAGTCCTGTCTACTCATGCATGTCTTATTTACTCGACAAGTCCAGCGAAATTGAGGACGAAGAACAAGATATTGAAAAGTCCAAGGATCCGATCGTCAGAGCTTTCCTGTTAAACCGGAAGTTGGAGAGTCTCATGGAGACGGAGTATGAATTCAAGAACGATTACAAACGACTGTCCAATAGATGCGAAGAGTTCGCAGTGTCGCTTCTTGCCAAGTGCCGATCGATGGAAGAAATCGGTTGTGTAATGAGTGTACCAGGGATTGATAAAATAAAGCATGTGGAGGTCAGAGGAGGGAAGGAAGCCCAGAAGCTGAGCGTGCTGAATTTTGCCATTGCTAATAGAAATGAAAAGTTTGTAGCTCACCCTTACAGCCAGCTCATGCTGAACTCAGTGCTGTACAACAGATTAGGAGGATGGGAAGACTTGAACTTCCTAACAAAGCTGCTATTTGGCCTGCTGTTGACCGCATTGCTACCAATATTGGCCCTATGCTATTTCTTAGCGCCTGACAGTCGGATCAGCGAGCTCTTACGAAAACCGTTCTTCAAGTTCGTCAGTCACACGGGTTCGTTTTGCTTGTTTCTTATGCTGCTCATTTTGTCCTCGATTCAAGACAAGTTTTTTGATGTTCTTCAGTTTTCAATCTTTGATTTTCTTTTAACACTGTGGATCACTGGCTTGCTGTTCCAAGAGGCAAAAGAAGCATTTCATCAGGGAAAAGAGCGCTACTTCTCACAATACTGGAATCTCGTCACGCTTCTCATGCTGGGGCTGTTTGTGATCTCGGGGTTCCTGTGGCTCGCTGGGTTTATCATGACCGCGGAAGGGCAAGAGACCTCGACGATACCAATCAGTGTGGCATTCGGTGTCAGCGCCAAAGAGTCCGCATACCGCCTTCTCCTCCTGTCCAATGCCTTCTTTTCTATCGGTCTGGTCTTGAGCTTCATTCACGCGTCCAACTCGTTTCAAGTGAACTCCGTTCTCGGCCCGTTGCAGCTATCGCTTATCACGATGATTCGGGACATCGCCAAGTTTCTGTTCCTGTTTCTGTTGTTGTTCCTCGCATTTGGTTGGGCGGAGAGGAAGGTTTACTCTCAGTACGTCCAAGCCAGAGAAGCCTTTGTTGGGAATGAGACTGAACATGAATTTGCCAAGATAGGAGGAAGCTTGAGGTTCTTATTCTGGGATTTGTTTGGAATGTCAGATTTGAAGGATATGAGGACAGAGAAAAACTTTATCATCACTCAGTACACGGGCGAAGTGCTCCTGGGACTGTACAGTATTATCTCTATTGTGGTCGCCATTAATATGCTGATTGCCATGATGGCGAACTCTTATCAGAGAGTCGCGGATGACGCAGATATTCAATGGAAATTCTCTAGAACCCGGATGTGGATGCCTTATCTCGATGAAGGCAACGTTATGCCGGCTCCATTCAACCTCATTCCTCCGCCATACCTGGTATTTCACCTCTGTAGAAGACTGTGCGCTGAGCCTGGGTCCTGTGCGCGCGGATGCTGTGGTGGACGAGATAGATCAGCATCCAAAATGAAAGAGAAAGTTGACATACAGAAGCGCCGAGTAGTGATGAAGCGTTTGATCCAGCGGTATCTTCTCACTTTTGAGAAGACAAGATGCCAATCCCTTGCTCCTCAGTTGAAAGCAGAGAGACTGGATGACGGCCATGAATTGAAAGATCTGATAAGTCAGTTGCAAGGCGTATTGGGAAGAAATGAAGATAGCAGACATTCTGCTGGGGCAGTTCAAACACAGACGGAGGAAAAGCCAAGGTAG

Transcript

OS493_026359-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9MYW0	Short transient receptor potential channel 6 OS=Bos taurus OX=9913 GN=TRPC6 PE=2 SV=2
Q9Y210	Short transient receptor potential channel 6 OS=Homo sapiens OX=9606 GN=TRPC6 PE=1 SV=1
Q61143	Short transient receptor potential channel 6 OS=Mus musculus OX=10090 GN=Trpc6 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001051 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF08344 all species →	TRP_2	Transient receptor ion channel II	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan
IPR002153 all species →	Family	Transient receptor potential channel, canonical	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR013555 all species →	Domain	Transient receptor ion channel domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10117 all species →	TRANSIENT RECEPTOR POTENTIAL CHANNEL	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005262 all species →	Molecular Function	calcium channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015279 all species →	Molecular Function	store-operated calcium channel activity	Interproscan
GO:0034703 all species →	Cellular Component	cation channel complex	Interproscan
GO:0051480 all species →	Biological Process	regulation of cytosolic calcium ion concentration	Interproscan
GO:0070588 all species →	Biological Process	calcium ion transmembrane transport	Interproscan
GO:0070679 all species →	Molecular Function	inositol 1,4,5 trisphosphate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026359-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026359-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

15.5Max TPM

5.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.78	15.50
polyp at pH7 6	18	18	5.70	9.04
coral polyp · control treatment	16	16	7.35	13.61
coral polyp · oil and dispersant treatment	16	16	3.60	10.70
coral polyp · oil treatment	16	16	5.56	13.52
coral polyp · dispersant treatment	16	16	6.18	15.51
Polyp	10	10	3.24	6.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.50
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.40
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.48
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.01
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.55
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.55
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.01
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.74
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.04
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.45
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.10
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.83
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.75
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.58
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.18
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.14
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.90
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.97
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.61
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.98
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.69
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.28
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.24
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.50
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.44
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.03
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.70
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.09
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.67
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.91
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.93
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.48
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.34
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.03
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.55
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.18
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.68
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.45
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.15
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.98
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.02
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.63
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.51
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.23
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.51
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.69
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.25
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.90
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.30
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.09
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.44
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.77
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.31
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.49
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.06
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.13
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.41
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.36
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.58

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.