Gene detail

Detailed information of OS493_026399-T1 in Lophelia pertusa

Genomic Location: scaffold_135:820214...835588
NR annotation: KAJ7377831.1, Protein smg7 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026399-T1

ATGGCGCCGATCCTTGGGTCGGTGCCCCAGGTTTTACGGCAAGCGGAAACGTTGAAAGCCGCTTTGAAAAGCAACTTTGAAGATTTCACTGTCGGCAGTGAAGGATGGCAGTCAAGACAAAGACTGCAGGATTTGTACAAAAGTATCCTGTTAACAGATCTCGAGTCTGCATTGGATAAGAAGGTTGAGCAAGACCTGTGGAACAGTGCTTTCAAAAGCCAGGTGGACTTTTTAAGGCAACAAACAAAAGACAGGAAGGGCTCAAAAAAAGTAGAAGTGCAGGCTGTTTTGACTTTGTTTCTTGAGGCTGCCAGTGGTTTCTATATCCAGCTGTTGCAGGAGTTGTGCTTGACGTACAGGCTAGACATCCCTGGTCATGTCAGGTCATCACAGTTGGGTATTCTTGAAGAAATTAATGGAAACACCAGTCCAGCGAAGAAACCTCACACTCAGTCTTGTTATTACATCTGCCAAGACTGCCTGGTGCATCTAGGGGATATTGCTCGTTACTGTGATGATCCTGAGCAGGCTGAAGTGTTTTATCGTCATGCTCTTGTTTTAGTTCCTTCAAATGGCCAACCTTATAATCAGCTGGCTATTTTGGCTAGTGGCAAAGGAGATGAGCTGGCAACAGTTTATTACTACTGTAGGAGCATTGCCGTGAAGAACCCCTTCCCAGCAGCATCAACAAATCTTCATAAAACATTGAGCAAAGTAGTTGCCAGGCATAATACAAGAGATGGAAGTTCAGATATACCAAAGGCAGAGTTTGGCCACATTTTCCTTCAGTTTCATGGTCATGTGTATCTAGTGCAAGATTTTGATCAGGCACGGACTCTCAAAGATCGCATTATTGCTGCATTAAAAGTAATCCTGACACAGAACAAATTCACTTCAGAGTTCCTTATCAAACTAGTGGCAATCACCTTGTTTCTGTTGTGGAACATCAGGACAGGAGGGGCAGATGATCTGGAGGAGTTTGACTGCATTGGCAAAGATGAAGAGGAGTGTTGGCAACTGGCTCTGGAATTTACAGTGGAGTTATTCGACACTCTTGTACTGCACGCTTGTGACAATGGGCCATCTAAGGAGCAGTCTGCAGGGTGTGATGTGCTTCCAGCTCTCAATCTACTGTGTCAGTGGATGACAGCATCATCTGCCAACATCTGGAATGGAGAGATGCTCAAGAAAACCAAGATTTGGGAGGACTTTGCAGCCTTATTAAATCTGTTACAAGTGACACACCCTCATCTACCTGAGAAAATTGACATTCCTCTTCACGAAGACTGGGAACTTCAGAGCTTTCTTCCTCTCAGGGTCAGTCAAAGGAAGTTAACTTATAGCATGAAGCGGACAAGACCAGATGATGAATCTGTGCACAGAGTTGGCAGGCTTGTTAGGTTTGGAAATCGTCTGGTGAATAACACGCCTCGTATCTTGGCTAAAGTGGAGGACCTTACAACTGGCCTATCCAACTTTTCCTTGAAGATAAACACTTCATCGCCCATTGAAGAGGAGGAAAAGTTCCCCAAGTCACCTCAAGACATTGATTTAGAGTCTGCAGGCCAAAAATTGCTGGCTTCTTTGCCAAACCTGAACAAGGCTACACCAGCAGGAACACCATTTGCTGAAACAAGTTCTTTGTTCAAGGGTCCATTAGATATTGGTCACATGTCAACAGGACATGTTCCACCCTCCCCCTCCTCAGTAGCTCAGTATTCATTGTTCCAGTCTGGGTGGAATGTACCTCTGACCTCTGCAGCTTTGTCTCACCCAGATCACCCATCCCAAAGACCTGTTGCAAAGCCACCAAATCACCGTGTAACCCCCACTGATCACTTGACGGGGACAGGGGGGAGCGCTGTATTCCCCCCCACCTTACCATCTCCCCCTGCTGTGCAAGAGAACCGCAGGCCCACCAGCTTTGGAACCAGTTTCCCTCCAGCGGCGGCGATGCAGGGAAATTTCAACTCTCCATCCCAGTCTCCTTTTGGTGGATTTGGGTTCAGTGGTGGCTGGAGTTCCGGGGTCTGGGCGCCAAACTCATCGAGTGCCAGTGGTAGTGGTGGGACGAGTCCTGGAGCACACGGTTTACAGTCTATCTGGGGCTCAGAATTTACTCCTCCATCTGAAGGCATGTCTCCACTACAGCAGCTGCTACAGGAACAAAAGAAACACCAACAGAAAGACACTTGA

Transcript

OS493_026399-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92540	Nonsense-mediated mRNA decay factor SMG7 OS=Homo sapiens OX=9606 GN=SMG7 PE=1 SV=2
Q1LVF3	Nonsense-mediated mRNA decay factor SMG7 OS=Danio rerio OX=7955 GN=smg7 PE=2 SV=2
Q5RJH6	Nonsense-mediated mRNA decay factor SMG7 OS=Mus musculus OX=10090 GN=Smg7 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005735 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10373 all species →	EST1_DNA_bind	Est1 DNA/RNA binding domain	Repeat	Interproscan
PF10374 all species →	EST1	Telomerase activating protein Est1	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045153 all species →	Family	Est1/Ebs1-like	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR018834 all species →	Domain	DNA/RNA-binding domain, Est1-type	Interproscan
IPR019458 all species →	Domain	Telomerase activating protein Est1-like, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15696 all species →	SMG-7 SUPPRESSOR WITH MORPHOLOGICAL EFFECT ON GENITALIA PROTEIN 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000184 all species →	Biological Process	nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	Interproscan
GO:0005697 all species →	Cellular Component	telomerase holoenzyme complex	Interproscan
GO:0042162 all species →	Molecular Function	telomeric DNA binding	Interproscan
GO:0070034 all species →	Molecular Function	telomerase RNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14409	SMG7, EST1C; protein SMG7	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026399-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

57.3Max TPM

15.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.20	21.78
polyp at pH7 6	18	18	17.59	23.21
coral polyp · control treatment	16	16	18.95	57.31
coral polyp · oil and dispersant treatment	16	16	13.93	42.24
coral polyp · oil treatment	16	16	15.06	23.10
coral polyp · dispersant treatment	16	16	9.97	20.14
Polyp	10	10	12.27	26.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.78
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.41
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.64
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.75
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.60
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.27
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.55
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.37
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.38
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.34
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.83
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.49
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.69
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.49
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.08
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.32
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.92
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.41
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.82
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.61
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.59
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.47
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.37
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.16
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.65
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.31
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.35
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.30
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.92
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.20
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.99
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.64
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.76
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.45
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.81
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.09
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.68
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.24
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.65
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.96
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.41
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.02
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.06
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.95
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.60
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.77
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.73
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.44
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.99
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.16
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.07
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.78
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.06
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.65
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.43
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.27
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.06
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.61
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.41
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.45
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.04
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	26.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	20.61
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.77
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.73
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.58
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.87
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.89
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.