Gene detail

Detailed information of OS493_026400-T1 in Lophelia pertusa

Genomic Location: scaffold_135:845107...858782
NR annotation: KAJ7377832.1, hypothetical protein OS493_026400 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026400-T1

ATGGTGACAAAAAAACAGATGAAAATCCAACACACGCAGCTCAATGAAGCATTCAAGCGCTTTAACATCACATTCGACTACAAAGAAGTGAATATACGAAACACCTCCTTACGAAGACGTACCGTCACCTACATGTGCGAGGCGGAGAAAATCGGCGACGGGATGTGCCATAAGCACTGCAAACACGCCATTACAGGAAATGATGGAGGCGACTGCGATAAATACCAAACCAGATGTGACACGAAAAAGCGCGGGAACGGAGTGTGCGACCCAGAATGCAACAGGTACTACAACGCGTGGGATAATGGCGACTGTTGCAACGAGAGCATCACCGATGTGTATCAGACTTGCTTCGATCCTAAATCGCCAAACAGGGCGTACATGAGCGACAGGGAATACAAGACTCTGGTGAATTTGAACAATAAAGATTTCTCGAACGTTTACTTGGCTAAGTGGAGCAATGATAACCTGCAGGGCGTGGCAACGTTTCCTTGGGAGAAATCCGTTCAAAGCATCTACGGCGGCACCATCCTGGGACTGAAGAATCTGGGGCAGAAACGGCACTCAAATGCCCTTGTTCACGAGTTTGGTCACGTGTTAGGCTTGTGGCACGTGCATCACGGCGTTGCGCCCGAGATGGATTGCACAGAGGACTGTGTAGAGAATTTCCCGTCGCTCGAGTTGGGTGATTTGTGCTCCGACACAAACCCGACGCCACCTAACAATAGGTGCAGTGATCCCGTTGTTAGCAAAGCTGCCATGACTTGCGGAGTCAAGAAATTCGTGAACACGCCTTTCAGGAACTATATGAGTTACGCTAACGACTCATGCACCGATTCGTTCACTGAACAGCAAGTGGCGCGAATGCACTGCTACATCGATCTGATTCATCAGTCATGGCAGGGAACAAAGACTCCGCCTTCCTTCATCCCGCTCCCTCCACGCGTCACTTCTAAAGCGGAGAACAGCGTTAAACTGGCTTGGATTCCACCGCTAGGGACTGGAGGAGGAAACGCGCTAAACGGCTGCCACGAGTGCAGAGAAGACAGAGTGTTTCAGCAGTACGCTGTGACAGCGGAGTCTCCCAATCCTGTCAAACCCAATGGCTTCTGGGCTCCTCACCAGGCCATCGGGGCCCCAGATGCTGAGCCTTGTAAAATGAGCCCCATAGGCTGGACCCCGTTCAAGCCTGATGTGATGGACCACTGTTCGGAATGTTACATCGAGTTTGGATTCAAGGAGGCTGTTATTCCGACTAGTTTGACCGTGTGGGTGATATGGTTCTCCAAAGAGGGAATTAGCAACATCCAGCTAATCTTCACGGATGGTTCAGAGCAGTCGCTAGGCAACGCTACAGCTCAGTGTGACGCCCCCCTGACCATACCTTTGAGAGTCAGAAAGAGGGTTTCAAGGGTTCGAATTCACGTCAAAGAACCTTCAACTGTTATTGATGCCATACAGCTGACGTCCTCTGTTGATCACCCAAACTGCCTGAAGTGCGAGCCCGTGGAATACCTAGTCACTCGAGAGCCCCCGTTTCCGTCTGGAAAGTCACAGCGTGTGAAGACGACTCGCTTTGAAGACAGGTACCTGGAGCCCGGAAAGCCTTACACTTACACAGTCCAAGCTACGACAAGTCTGGGGCTTGAGGGTCCTCCATCCCCACCACTGTTCTACTCGCCAGAACAAGGTTTTTGTGGCGACGGCAAAGTGGACCAGAGTATTGGTGAAGAGTGCGATGACGGGAACGTGCGAGACGCTGACGGCTGTAACATGCAGTGCAAGAAAGAGGATGTCTTCCATTGTACAGGTCATCCAAGTTTGTGCTACCGTCACGAGGGAGACGGGAAATGCGAATATTTTGAGAAGAAGACCAACATCAAAGACTGTGGGTTCTACACACCAGAAGGATTTGAAGATCAGTGGGCTGTGAACGTGACAGTAAACTCTGACTACCGTGACCAGAGGTGCCCGGAAAACGTGGTTCTTGGACCGCCACCACTTGACCTGGTTTGCCAGCCTTCTTTTGATGACGAGTATAAATACGCGTGGGGTCCCTGTAAACACTCATACACGGACAGCAATTATTGGCTGGAGGTCACTTTCAATCGGTCCGTTGTGCCTGCGGCAGTTGTTCTTTATATCGGCTCCGATGGTAAAATAGATTACAGGCCCTATTATGACAAGACCATCAAGACCATCAAAGTCGAGCTTATCGACAACGTCGGCCGCGTCATCCCCTCGGGCAACAAGGAAACTAAGCTTTCATGTAAGACAAATCCAACTGTCATCCCAGTCCACCACGACATGACGGAGCCATTCTTCTACGTGCGTAAGGTTCGCATCAGTTTCAAGTCGTATCTGATCAGCATAGCGGCCGTCGCTCTTCGTTCCAGGGCGCAGTTTGATGTAGTTGAAATGTCCAAGTGTAAACCGGACGAGGTGTTCAGTCCCCGAACTCAGCACTGCCACAAATACATGTGCGAGAGGCCTTCGTGTCAGGAGCCCGTGGTGAAACATGGCGCGGTCAAGTGCGAGGGGACTGAGGAGGGGCAGACGTGTACTGTGACTTGTAAGCCTGGTTACCGACCATTCAAGTCGTTCAAGATTATTTGTTTGGATAAAGATTGGGAGGGGATTCATAGAGCCTGTATGCCTCTCAGTTGTGGTGTCCCAAGAATTCCTAACGGAAAAGCCGATTGTCCACAGGGTAACTCGTTTGGGAAAAAGTGCTCTCTGAAGTGTGCACCGCGGGCCAAAATGAGCGGGGGCGAAGGCAGTGTCACGTGTGAGGAGGACGGCAAATGGTCCGCACAGAGTGCATTCTGTGTTATGACTTGTCCGAACCCCACGACACCGGAACACAGCGAACCTCTCGCCGAAAATAACTGTATTGGCAGCAAGAGGACATTCCTACCAGGCGTGTCCTGTAAATTTCGATGCAAGCCCGGCTACAGAGTGAAAGATAGAGAAGATCCAGGGCGAAGGATCTTGAAAACGCGCTGTACTAAAAGTGGCAGATGGACTCAACCAACATGCGAGCCAATAACCTGTCCGGCACTCACGACAAATCTGCTCATGTGGTACAACTGTTCCCATGGTAACGCTCTGGGAAGTGTTTGTGTGAATTATTGTCCAGGAGAGGAGATTCACGAAGTCAAGTGTGAGGAGAATGGACAGTGGAATGAACCGTTGAAGCGTTGTAAATCCCCCAGTGCTGGTCGCTGTCCAACCCCTAAAGAATCACCTGGTGTCTTATTTGTCTGCGAGGATTACTTCCCTGGAGGAATATGCAAAGCCAAATGCAAAAATATTGCACATGATGTTGTCGAACGTGGAAGCGAAGACATGTGGCGCGTGATCATCACGTGCACACAGAAACTCGACTGGTATCCAGATCCCGCCAATTTGCAATGCGTCCGCGGTTGTCGGAAGGGCGAAATCGCCGATGGATGGTGCGACGCGGTTAACAATAACAAGCATTGCCGATGGGACGGGGGAGACTGCTGTCCGTCTACCACAAAGCATAGGATCGTTCGTCCCATGCCTAGCTCGTGTACATCGGACTGCGCGTGCAAAGACCCTGAAGCGAGAGAGAATGGAGGCTTCGTCAATGAAGGCTCCAGCGGTGTGGATGACGAAGATGACGATGGCGATAAGCCAGAAGGAAGTGGCGAAGAGACACAGTCCAGGACGTCTACACGATGA

Transcript

OS493_026400-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13219	Pappalysin-1 OS=Homo sapiens OX=9606 GN=PAPPA PE=1 SV=3
Q8R4K8	Pappalysin-1 OS=Mus musculus OX=10090 GN=Pappa PE=2 SV=2
Q9BXP8	Pappalysin-2 OS=Homo sapiens OX=9606 GN=PAPPA2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003859 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05572 all species →	Peptidase_M43	Pregnancy-associated plasma protein-A	Family	Interproscan
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR008754 all species →	Domain	Peptidase M43, pregnancy-associated plasma-A	Interproscan
IPR000800 all species →	Domain	Notch domain	Interproscan
IPR043543 all species →	Family	Pappalysin-1/2	Interproscan
IPR003961 all species →	Domain	Fibronectin type III	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan
IPR011936 all species →	Repeat	Myxococcus cysteine-rich repeat	Interproscan
IPR036116 all species →	Homologous_superfamily	Fibronectin type III superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46130 all species →	LAMGL DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0007166 all species →	Biological Process	cell surface receptor signaling pathway	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026400-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026400-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

170.8Max TPM

22.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.70	11.63
polyp at pH7 6	18	18	9.89	18.59
coral polyp · control treatment	16	16	18.52	52.67
coral polyp · oil and dispersant treatment	16	16	28.26	55.51
coral polyp · oil treatment	16	16	17.77	36.54
coral polyp · dispersant treatment	16	16	67.14	170.84
Polyp	10	9	1.23	3.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.57
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.20
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.16
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.22
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.07
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.45
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.28
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.28
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.99
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.89
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.47
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.26
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.74
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.31
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.15
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.46
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.99
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.63
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.42
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.28
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.12
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.77
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.39
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.16
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.30
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.04
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.60
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.84
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.51
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.65
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.25
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.86
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.52
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.77
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.62
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.25
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.65
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.34
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.87
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.70
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.49
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.54
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.07
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.79
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.62
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.59
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.80
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.13
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.17
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.38
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.02
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	170.84
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	120.85
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	118.52
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	104.64
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	96.84
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.03
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.57
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	78.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.54
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.28
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.90
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.85
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.44
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.88
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.85
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.79
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.27
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.08
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.