Gene detail

Detailed information of OS493_026512-T1 in Lophelia pertusa

Genomic Location: scaffold_137:446391...457600
NR annotation: KAJ7356131.1, hypothetical protein OS493_026512 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026512-T1

ATGGTTAGCGGCGAGAGTACATCTCTAGTCGACTTCGTTAAAATGACTAACCCCGGTTTATTTGATTTCCAGGACGAGATACACTCGTTCATCGAAGCGTTGCTTCCTCACGTCAAGGCTTTTGCCTATACGTGGTTTAATTTGCAAGCAAGAAAGCGAAAGCATTACAAGAAGCATGAAGTGCGAATGACTCCGGATGAGGAGAGAAGGTGTAAGGAGGAGCTAGATGCTGAAGCGCCAGAAGTGAAGCAGAAGTGGGCTTCGAGGCTGCTGGCAAAGCTGCGAAAAGACATTCGACAGGAGTGCAGAGAGGACTTCGTGATGTCCGTGGTTGGAAACAAACCCGGCTCGTCGTGCCGTTGCGTCATTTCCAACCCTGATCAGAAGGGGAAGATGAGACGTATAGACTGCCTCCGTCAAGCTGACAAAGTATGGAGACTAGATCTTGTTATGGTGATTCTCTTCCGAGGCATTCCGTTGGAAAGCACGGACGGTGAACGTTTGGGCAAGTCGCAGCACTGCCAGAGTCAGACCCTGTGTGTTTTGCCCAACCATATCACGGTGACAGTTCGAGAACTGGATCTATTCCTGGCGAACTTCATGTGCAACCGAGAGCACAAGCAGGATTCCAACAGTCCCGTACGAAGTTCTAGCGATCCAGATTCTCACCAAATTGGCACAGAGCAGAATTTGGTTTCATCTGGTGTGTTTACAGTAGCTGAGCTCTATACCTATGCCAGAACACCTATCAAGTGTGTTGGTTCATCACATGGTCTCATGTTATCGGACCTGGAGAGTCCATCATACGGCGATGCAGGCCTCGAGCAACGTTTTCCAAATGCAGTAAACATACACCCACGACCAGATACATATGACCTAAGGTACAGAAAAAGAAGTCGGACAATTAGTTCTGTTTCGTCAGTTGATGATGATTGTGATGATGATGACAGGGACAGCACAGGGCTCTATGTCCAGTCACCAGCAAGTTTCTCATCTCAAGGGTCTAACTGGCAAAATGACGTAGACTCTGGTTCCAGTGTTATTCACTCTCCTATGGTCCCATACCCTCCCAAGATCAAACCAGAACAAAACTGCTCAGGATACAGTCCACTGGAAAACCACAATGTAATCACTTGTTGTAATGTGAATGAACCTCAGTCACCTGCCATCACATCGTATGGTGGTCAAGCTCAACAGCTGCACAACAGGCAAATGAGAGACTGTAATATGAATGACACTTCATTCATTATGCAGTTAGCATCAGCACCTAAAGGTCATGTACCAGCGAGTTGTGGGTTTGGTATGAATCTTCCACAGCAAGGGTTTACATTCCGTCTCCCAATGCCTAATGCTCACATACCTCCTGTAGGTTCTGCTCCTTGTCGTACTGGTCCACCAACTAGTGATTTCATCCAGCTTCTGGAGAGGCCCCGGTCCAGTTCAGCACCAAATACTAGGCACTATGTTCCTGGGACATCAGCGGTCATACCTCCCCCTTTAACAAGATCACAAAGTGGCAACAGTATTATACAAAGCACTGGCGGAAACAACATGAACGCAGCAGATCCACGGAATTCTCCAGTTCATCAACAGCAACAATCACCAGTGTCAACAAGCCCAAGTAAAACTAGTCCACCTTCAGGAATAACACTGAACACCACTGTTCAGATTATCCAGTCTCCAACGAACAATCCCAACAGTGTAGCATCAACCTATGGTAATCAAAATCCACAAGTGTTCAGCTATCCAAACTTGACACCTGGCTGTCTATCTGCTGTCAACCCTTCAATACCAATGGGCCTGTTTACATCACAAGGTATCACACCAAGGGGTAACATACCTCCTCGCTGGGCTACAGCCATACCGGTTGCACCTGTCTCCAGTGGTGGAAATGTTGTGTCTGAAGAGGAGTCAACAGACTACCAGATGGTGTCGGGGTTTGGGGGTATGAACCCTGATGAGAGCATGCTGGAAGGTTGGTGTCAGAGAGGAATTTCTTCCCAGTGA

Transcript

OS493_026512-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P13623	Nuclear factor 1 X-type OS=Mesocricetus auratus OX=10036 GN=NFIX PE=2 SV=1
Q12857	Nuclear factor 1 A-type OS=Homo sapiens OX=9606 GN=NFIA PE=1 SV=2
P09414	Nuclear factor 1 A-type OS=Rattus norvegicus OX=10116 GN=Nfia PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002791 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00859 all species →	CTF_NFI	CTF/NF-I family transcription modulation region	Family	Interproscan
PF10524 all species →	NfI_DNAbd_pre-N	Nuclear factor I protein pre-N-terminus	Family	Interproscan
PF03165 all species →	MH1	MH1 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000647 all species →	Family	CTF transcription factor/nuclear factor 1	Interproscan
IPR019548 all species →	Domain	CTF transcription factor/nuclear factor 1, N-terminal	Interproscan
IPR003619 all species →	Domain	MAD homology 1, Dwarfin-type	Interproscan
IPR020604 all species →	Domain	CTF transcription factor/nuclear factor 1, DNA-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11492 all species →	NUCLEAR FACTOR I	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026512-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026512-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

210.1Max TPM

53.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.00	34.33
polyp at pH7 6	18	18	25.13	44.59
coral polyp · control treatment	16	16	61.06	153.02
coral polyp · oil and dispersant treatment	16	16	94.40	210.06
coral polyp · oil treatment	16	16	62.12	112.47
coral polyp · dispersant treatment	16	16	90.06	165.24
Polyp	10	10	9.09	17.01

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.33
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.81
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.13
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.03
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.36
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.85
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.61
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.50
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.74
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.65
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.25
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.59
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.61
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.31
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.80
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.63
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.16
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.18
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.16
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.33
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	153.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	105.82
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.72
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.09
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.47
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.73
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.64
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.29
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.71
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.49
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	210.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	171.67
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	132.40
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	126.60
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	111.04
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	103.37
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.52
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.65
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.64
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.55
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.80
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.30
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.06
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	112.47
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	112.01
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.49
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	89.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	85.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.91
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.61
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.27
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.02
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.76
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	165.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	148.50
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	137.66
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	130.83
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	117.31
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	103.59
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.22
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.33
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.62
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.04
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.51
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.95
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.01
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.16
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.05
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.94

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.