Gene detail

Detailed information of OS493_026575-T1 in Lophelia pertusa

Genomic Location: scaffold_138:227959...236470
NR annotation: KAJ7327697.1, hypothetical protein OS493_026575 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026575-T1

ATGAGCTTACTGAAGAAACTTGCGTCCTTGTCGCCTCTTCAATCCCCGAGTTCAGACGCCGAAAAGAAGCAATTGAACGATGGTTTTGTAGAGCTGGGCGCTTCAGATTATTTGAAGCTGGTCGATGTACATTGGAAAAATTCAAAGGCAATAATAGCCCTGAACGAGAAAACTATTGCACATCAGGAGAGATGTAAAATGTTAGTTGACAATTTAAATGGCATTGTTTCTGTTTTAGTTGACGAGAAGGATGGCGATCCCGGGCCGTGTTTACAATATGTTTTGGACGAGAATGTGTTTCAAACAGTCTACACCTGGAGCGTATCGAACAAAAATTGCATCAAAGATATGAAACGGGAGCAGCTGAGGTTATTCAGGAACCTCATAGAAAAAGGCAGAGCGCCTTTGCTAATATACGAGCAGATAGCTAAACTGTCCTGTGTTCTCACTGCTCATTCCTTTTGTGCATCGAGAAGGAAATGTTGGAATCTGGGCTCGGATGCGATGTTGTTATGCATGGCTCTATCATCAGTCGACACAAGATTGGGAACATACATCGCGGAAGAGACGGACTTTTGCTTCGTGTTGGCCACAGGACTTAGTGCCCTGTACTCTGACCTGCCGTCCTCACTCGACATACCATCGGAAGACTGGTATTCTTTGGAGAGGGGACTGTGGGCTACATTTCCTGAACTGGTGTCCTTTCTGACATCACTGGAGTTCTGTAACAATGTTATTCAGATTGCCCATCCTCAAGTCCAGTACAAGCTGTTGGATCTCATTTACCATGGATTTCTTGTGTCTGTTATGGCATCCTCACTAAGCCAGTCCTCCACTGAAGCCTTAATTGCGGCCACATCCTACCTGGACTTGTTTCTACGCAGCATTACTGATGCCAACTTGATGAAAGTGTTTCTAGAATTTATTATGGTGGAGAGATGTGATGGTACTCCCATTCTTGACTTGCTGGTGTCACGGATTGCACATGAATCCCAGCTTGCTGTTGTGTCGTTGGGTTTGTTTTACACTCTGCTGGACCTGAATTGTGAGGACATCATATATAGCTTGGTGCTCAAATATCTCATCCCATGTACTCACATCCTGAGCAGTCAGAAGAGAACCATCAAGGAGGTGGATCTTTACAGCAAGAGCGCCTTCAAGTTCCTGTCGCTGATTCCCGCTTGCTGTAGCTCCAGTCAGTCCTCATCACCTTTCTCCTCCTCAGAGAATTTAAATGGAAGCGCTCCCAACACACCGATGAAGATCGACCTCAAGGCATCAAGCGAGTTGGTGTTATACCGCTCGCCTCTCCTGAGTGATCTTTACGCTGAAGTCTGTGCGGATTACATGGAGTACTTAGCAGACGCACGTAATTTACTGAGAGTTTGCCAGATGAAGTGTTCTTGTTGGTCCTCACCCTACGACGGGCAAAACCCAGCCCCACCAGACACCTCGATCGAGCGAGATCGAGCGTCCTCCAACTTGTCTGCACCCGTTGCCAATGGCAACATCCCAAACCAGGTTTTCTTGGCGTCTGAAGATGCGCCTGCTCCTGTGAAGCGACCAAGATCAGCGAGTGAGTTTGAACAGAAGCAAACTAAGCCAGACTTAGGACTGTTTTTTAGTGACGCTGTTTCAGAAAGTGGAGCGTATGGCGCAAAACTCGTTTTATGTGAACTTGATTTTGACCGGGGTGGTGTCGAGGCTTGCTCTGTACCCTCAACCGCTACTGCGCTCATTTCTTCTCAATTACAACATGGTTCTCAAGCCAGGAGTACGCTCATTGTTTCAGATCCTGAGTTCGGTGAAAATCAAGACATACAACAACCGTTGAAAATAGCCAAACACACCGAACTCAGAAACCCCGGCGGCTCAACGGCTCACAAGTTATTGAGACAAAAGACAGACTCTTCGCTGTTGAGCAGCGTTCGCTTGCTTCAAGATGGGCCTCCGCCGAAGAGTTTTGGCAAGGGAGCTGCTCCTCATCTGCGCAAACAGTCCCTGGATGCTTCTATGAGTCCGAGATTGGTAAAAGCTAATCAGGAAAGACGCGCGAGTAATGTGAGCACAAGCACCAGCTCCAGTCTGTCCCTGAGCGAGTCTTGGGAGAGCTTGAACTCGCTAAGCCCTAAGTTTGGAAGCACCGCAGATGTTACCGCGGAAACCCACCCCAAACCAGGCACCATTCAAAAACTGGTCAGCCCCCTGAACTCGCCAAAAAATTCGTTTCCGAAGAACACGTTCAAGAGAAAGAACCCGAAGACTGTGAAAAACGCTGTTTACTGTATTGTGGTTTTGGAAGAATGGCTCAAAGAACTCGCCGCGGTGTCTCAAGAACATGCGCTGTTGCTTGGTGGAGGAGATGAGTGGCATACCGCTTCCCTGTGA

Transcript

OS493_026575-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7S6A1	FHIP family protein v1g243165 OS=Nematostella vectensis OX=45351 GN=v1g243165 PE=3 SV=1
A7YY62	FHF complex subunit HOOK-interacting protein 1B OS=Bos taurus OX=9913 GN=FHIP1B PE=2 SV=1
Q3U2I3	FHF complex subunit HOOK-interacting protein 1B OS=Mus musculus OX=10090 GN=Fhip1b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007621 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10257 all species →	RAI16-like	Retinoic acid induced 16-like protein	Repeat	Interproscan
PF19311 all species →	KELAA	KELAA motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019384 all species →	Family	FHF complex subunit HOOK interacting protein	Interproscan
IPR045668 all species →	Conserved_site	FHF complex subunit HOOK-interacting protein, KELAA motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21705 all species →	RAI16 PROTEIN-RELATED	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_026575-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026575-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026575-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

33.5Max TPM

8.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.32	11.47
polyp at pH7 6	18	18	8.06	11.07
coral polyp · control treatment	16	16	12.62	33.50
coral polyp · oil and dispersant treatment	16	16	9.32	26.97
coral polyp · oil treatment	16	16	8.42	11.46
coral polyp · dispersant treatment	16	16	6.54	13.19
Polyp	10	10	5.33	7.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.47
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.29
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.69
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.35
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.32
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.02
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.76
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.19
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.86
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.43
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.35
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.22
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.69
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.07
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.05
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.81
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.66
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.64
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.47
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.50
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.70
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.64
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.99
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.17
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.91
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.89
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.90
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.65
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.48
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.31
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.61
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.15
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.59
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.50
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.61
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.23
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.41
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.23
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.03
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.69
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.65
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.50
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.04
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.84
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.53
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.19
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.75
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.42
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.68
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.22
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.08
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.56
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.90
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.38
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.06
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.94
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.85
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.01
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.60
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.