Gene detail

Detailed information of OS493_026640-T1 in Lophelia pertusa

Genomic Location: scaffold_138:846770...871984
NR annotation: KAJ7327761.1, La ribonucleoprotein domain member 1B [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026640-T1

ATGACTGAAGTCGAAAGCGTTCCTAAGACGAAACTCGATATCGTGGAGGATGAAAATCACATTACCAACAGTTGTGAACATGTCGAAGAACACGTAGAAGTCGAGAACCATACTGGTGAAGGAGAGGAAAACGAAAATTTCAGCGAAAACACTTCGCAGAAAGAGGAGAATCGCAATGATCCCGTCGAACCTCCTCCCCCGCCAAAAAATCCTTGGACAAGGCACTTGAAAAGCAATGGCGAGAAAGAAGAAGCAGCAAAACCGACTGTTGTGAAAGCCGCAAAGCGCAAAGGCAAGGGCAGTGAATTTACGGATATAACCAACTGGCCAACTCCTGGTGAATCAACGGCCTCCGGAGGAGGAAAGACGACTGTTATCAAGAAAGAAAATGCCGAAAACGAACTATCAGGTGAAGAAGAAGAGAACGGAAAAACAACGCCGAAGAAAAAAGGTGGTCGTCAGAAGTGGGTCCCCTTGAACCTAGAAGGAGCAGAAGGTGCCATAGAAAACTCTAGCAGTGATGGGGCTGTATTGGACAAATCACCAACGTCGCCAGAGGCTACTTCGCCAACTGCTGTTAGCGCTAAGCCAGCCAAGTCGCCCACCAGCAGGTTCAGTCCTGGCAGCATGCCAGGGAATTTATCCCCTGTTAGAGGTGGCAGGGGCGGGCGAGGAGGAGGAAGAGGCGGGCGTGGTGGACGGGGACGACAACGCTCCCCAAGAGGAGATGGTCACCAACAGATGCCATACAATGCAGCATACCGACAACAGTTTGGATATCAGTTGTACAACGGTACAACTTACTTTGCGCAGCCACAGTATGGTAACAGTCAGCCGCCACAGCAGTTTGGGAACAATCCACCGCCGCCGCCACAGCAGTATGGCAACAATCAGCCCTATAGCTCAAATTTTTACTACAATTCTGGCAACTATATGCCTGCCGCGGCTGTATCTTTGGATGACGGCACCCTGAGAGAATGTGTCAAGAACCAAGTAGAGTACTACTTTAGTGAACAGAATCTTCAGAAAGACCTCTTCCTGAGACGCCAGATGGACAGTGAAGGCTTCATTCCTCTTGCACTGATAGCAAGCTTTTATAGAGTTCAGGCCCTCACACAGGACTTCAACTTCATCTTAGAGGCACTAAAAGGAAGTGAAGCTGTGGAGCTAACTGATGGTAAAATAAGGAAGAAAGACAACCCTGCCGTGTGGGCAATCACTCCAGACCAACCCATTACAGAAGCTGAGATGTCAGCTCATATGGAGCCACCAAAACCAGGCAACAGGTTCAATAACATTGACAATCCAAGTGAGATGATCAAGCAGGCACAGAAGGAATTGGTGTTCAATAACTCGTCCAACAAAGAAGACATTATGGAACAACAAGGTGCAGAAACAAAAAGGTCAGATCCCGAAGCATGGACAGAAGTAAAAAGAAGGAAACCATCATCTCTAAAGATCGATAGCAAGACTGGTTTCTCTAATGACCAAGAAGAACTGGACTTCCAGTTTGACGAAGAACTAGAACATCAAGGGAAGCAGCCAACAATTTGCTCGTCAGATTGGGATGATGATTCTGACGATGAAATAGATGATCAAGACATACACAAAATAATGATCGTCACTCAAACCCCACCTCCCGTCAAGAAACACGACCGGACAGGAAGTTATGTCACCAGAGTTAAAATGACGCAGGAACTTTCCAAAGCAATTAACGATGGACTTTACTACTATGAACAGGATCTTTGGGACGACAGCGATGATAGTTATCTAAACAGAAAGATCGTTCTTTCTTCGTCATGGAAACGTGTTGAGATTGTAAGTCGGGACAAATTCAATTACCAGCGTGTCGCACTGGAACTACCAAGAGCTCGCTCATTCACAGAAGCAGAATTCCCCCCACCCAGCCCTCCCATAACGACAGTTCCTCACGCTGCACTATCGCCATCAGCAGAAGTATTCCGTCCACGAGCAAACACTGCCCCGCCCGAAACCCTGTCTAGGTCTCTTCCGACTACTGTTCCCGAGTCTCCCACCGACCTGGCACGACATGGATCACGCACACCCAAGAGAAAAGACGTTAAGGTGGCACCCAGGTTCTTCCCTGCATTTAGCAAGGAGAATATCAGTGATCAGGGACCAAAGAAAAGGAAGACAAAGTACAGTCAGAACCCCCCTGTGGAACAGCATGTTGGCTGGGTGATGGGTACCAGGGACTATCCACCACCAAGAAGTCCAAGCTACAGTATCTCAGAGGGTATGGCTCCTGTTGTCGGTAGTTACGGATCAACGCCGCAACCAATCCCACGCTTCCAGCATCCCTCGCATGAACTTCTGCAGGATAATGGCTTCACTCAACAACTCTACCATAAATATCATTCCAAGTGTCTGAAAGAGAGAAAGAAGGTAGGAATAGGCCAATCACAAGAGATGAACACAATGTTTAGATTCTGGTCGTTTTTCCTCAGATCCCATTTCAATAGGAAAATGTATGACGAGTTCAGAACTTTAGCAGTGGAGGATGCCATAGCGGGTTACAGATATGGTTTAGAGTGTCTCTTTAGATTCTATAGTTATGGCCTTGAAAGAAGGTTTAAAGCAGACTTGTTCAAAGACTTTCAGACAGAGACGATGAGAGATCACGACCTAGGGAATCTTTATGGTCTTGAGAAGTTCTGGGCATTCCTCAAATATTACAAAGGAAAAACAAGATTTGAAGTTGAACCAGAGCTTCAAAAGCGCCTTGAAAAGTTTAAGACAATAGATGACTTCAGGAATGATCCAATGAATCAGTTCCCTGTCGACCCACACAGCAACAAACCACGATCCAGACACAACTCACACGGAGACAAACACGATCACCATTCTCACGGCAGCAAGGAAGAGCAAAAAACTAGCAAGGAGGATAAGAAGAGCCAGAGAAGCAGCAGCGAAAGCAGCGATTCAAGAAGGAAGAGCACAGAACGTAAAGTAGAAAAGGAGAGCTTACAAGAAGAAAAGGACAAAAAGAGTGCGGCAACTGGTGAACAGAGCAGCACAACTGCAGCCTCTGAAACTACTTCTGGAAAAGCTGCTTCCGGTAAAACCAGTTCCGGTAAAACCAGTTCCGGTAAAACCAGTTCCGGTAAAACTGCTTCTAGTATATCTCCTTCCGGCAAAACCACTTCCGGCAAGACCACTTCCGGTAAAACTACTTCCGGTGTAGCTACTTCCGGTGCAGCGGCATCCTCGGAGAGAACAGATGCTGCTACGGGCTCGTTAAACAAACAGCAGAGTTCTGAAGCGTGTGCACCTGCCTCTGGCAAAGCAGCGAGCTCCTGA

Transcript

OS493_026640-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q659C4	La-related protein 1B OS=Homo sapiens OX=9606 GN=LARP1B PE=1 SV=2
Q6ZQ58	La-related protein 1 OS=Mus musculus OX=10090 GN=Larp1 PE=1 SV=3
Q6PKG0	La-related protein 1 OS=Homo sapiens OX=9606 GN=LARP1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005211 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05383 all species →	La	La domain	Domain	Interproscan
PF21071 all species →	LARP1_HEAT	LARP1 HEAT repeat region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006630 all species →	Domain	La-type HTH domain	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR006607 all species →	Repeat	LARP1-like, DM15 repeat	Interproscan
IPR045180 all species →	Family	La domain containing protein	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22792 all species →	LUPUS LA PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000339 all species →	Molecular Function	RNA cap binding	Interproscan
GO:0048255 all species →	Biological Process	mRNA stabilization	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0010494 all species →	Cellular Component	cytoplasmic stress granule	Interproscan
GO:0045727 all species →	Biological Process	positive regulation of translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18757	LARP1; la-related protein 1	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026640-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

72.8Max TPM

32.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.49	52.09
polyp at pH7 6	18	18	30.76	42.04
coral polyp · control treatment	16	16	42.50	72.78
coral polyp · oil and dispersant treatment	16	16	38.39	54.09
coral polyp · oil treatment	16	16	32.89	46.94
coral polyp · dispersant treatment	16	16	33.20	53.50
Polyp	10	10	12.54	24.54

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.09
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.34
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.51
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.42
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.05
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.45
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.11
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.05
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.34
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.62
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.17
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.04
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.84
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.48
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.98
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.78
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.97
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.16
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.29
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.17
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.24
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.04
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.43
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.78
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.35
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.82
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.72
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.09
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.71
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.52
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.47
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.29
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.31
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.22
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.89
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.36
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.31
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.36
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.58
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.40
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.51
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.70
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.56
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.54
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.29
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.02
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.83
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.47
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.27
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.41
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.50
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.50
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.19
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.83
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.97
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.37
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.76
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.52
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.08
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.55
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.54
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.39
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.68
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.49
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.84
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.96
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.93
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.31
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.93

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.