Gene detail

Detailed information of OS493_026667-T1 in Lophelia pertusa

Genomic Location: scaffold_139:198024...224051
NR annotation: KAJ7390160.1, BAI1-associated protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026667-T1

ATGTCTTCGGAAAACGCGGCCGAAAATCAACAACAACGTGAGCGTCTGCGAAAATCGCGAAAACTTGGTCTCTGCCAAAAGCTATCTGTTCAGAATCGAGCTTGCTACTTGGATGGTCAAACACCGTTTGAACGAGCTCAGAACTTTGATGACAATTACTTTGAGAAGTTTAATTCATTGGACCAGAGTGAAAAGCAGGCAGAAAACCAAAATATTAGGGACGTTGTCATTGATGAAAACCTTAACCATGCCGAGGAAGATGAAGGATGTGATGCAGAGGTGTTGTCAACTTTTGCAACTGAAGCAACGTTAAATGAAAAACAGCGTGCAGCATTGTACTGTGAGCTACTGTATACTGTGATACACCAGCTTGGAGCACATGACAAGACAGCAGACCTCTCCCCTGGGGATTTATTTGTGTATGCTCAAGAGTCCCTAAACATTTCAGAGGAGACGCACAGAAATCTTTATGCAATTACAAAAGAAAGGGAACCTCCCACATGTATGATGAAAGTGGAAGTTCTCGAGGCCAGACATCTGGAGGCAAAAGATGCAAATGGGTTGAGTGATCCCTACTGCATGTTAGGAGTAATGACGGAGGAAAATGAAGAAGAAAAGACCAAAAAAATGAAAGCACATCGCAAGAAATCCAGGAGCACAATCAGGGATGTTCTTGATGGAGAGTCCATCCACATGACGCAAGTCAAGGAAAACTCCCTCAACCCAGTATGGAATGAAACATTTACAATGAGAGTTAGGAACTTACACACAGATAAATTTCACCTTGATATTTGGGATTGTGATGACAAGACAGTACTAAAGGAAGAAGACAACAAAGTTTCCAAAATAAAAGGAATCTCTGGAGTGGGAAGATTTTTCAAAGATGTGATGCAGTCTGCAAGAAAGTCCAGTCAGGATGGTAATATTGATGATTTTCTTGGATACATTGAAATTCCAGTCAAGGATATTCCAGCTGATGGCATTGACCGGTGGTTTAGACTTGAAGGACGCTCGTCCAAGTCACGAGTAGATGGCGACTGTCACATTAAAATTACTCTAACAACGGGAAAGAAACCAGAAATTCCATTTGAGATACAGCATCTGTACCCAACAGGCATTGATATTCATGGAGCGTTTTTAAAAGAATTTATCAAGTATGGCTGTGAACATTGTCAGGAAGCTGACGATAAAAAAAGTACAATCGAGCTTTGTCCTCAAGCAGAATTCATTCTTCATCAGCATGCTTTACAGAATGAACTGACTGAACTTCAGCAGGCTAGCATTCGTTGGATTCTATTCAGTCATCATCACTGGCTGGAGCCGATGAAGTACAGCTCGTTAGACCTCCTGCTTTGGACTCTGAAACAGAGATGGAAGACTGGAGCACTCAGTCAAAGAGAGGAACATTCGTTAGTCAGATCTTTGAAGAAGTTCACGGATAACTGCTGGAGATTGATGATCAAATATCGAGATGTCTTCCCTGCAACAGATAAAGGAAAGTTGACTCGATTGATAAAACTTCTGGAGTGTTTGGTAAAAGTGTACAAGCTTGAAGTTTTCCAGGATTCAATAAAAGAACCTTTGAATGTTCAAATGTCAAATATTCTCAAGGAATCAGCCCTCGCTTGGTACAAGAAGGTGTATGCTTGGAAGGAGCCTCAAACAAAGAGTGAAGAAGCCATGTTATCAGCTATGGTAGAAGTTGCTGATTCATTAGTGACTGACATGTTTCAAGCCAAGGCATGTTACAGAAAGATCTTCTCTGTGACCGAGGTGAAATATTTCACTACAGTTTACAATCAGTTGGAACTAATGCTTGCATCGGATGTTCACAACACGATGAGGAATATAAACAAGCGTCTTAAACAGGAAGGCGGTGCTGACATTGTTGGAGAGAAGCTGTTTTCATTGTTCTTAGCTGTCAAGGAAGTTATTAGTTATCGGAGCATCGGAGAAGCAAAGCCAGACCATGTGTATGCTCTTGATGACTATCACACCTGGTTCAAACAGTCCGTTATACGGTGGCTTGATATTGCACAAGTCAAAGCCAAAGAGCGAATCAGAAAAGCAGTTGAAATTGACAAGATTTTGAGGATTGATGCAAGTGTGAGCCACTCCACCTCAGCCATTGATGCAGTGGGCTGTTTTCATCAGATCCGAGAATTCTGGAAGAAGATAGATTGGCCTGACGCATCCGGATCATATGTGTTTGTTATGCAAATCACCAATCAAATTTGCAGCAGTGCATCGTATTACGCTGATCTTCTGTTCGAAAAGATGATTAAAAATAATTATTACGACGAGGATCCATCTCAGTTTGACGTCAGTGAACAGTTATGCGTTACGTTGAATGACATTGAATACATGAGGCTGTGGTTGTCTAAACTGCCAGAGAACCTGGGCTGGGAAGACGTCATCAGTGCCATGATGGATGCACACGGCGAGCGAGGCGGGAAACACGCGCGCACCGCCCTAGAAAACATGCTGTCCAGCTCAGATGAAGACATGCTTAATAAGATCGCTGACGCCGTCGAACACATTGGACAGAAGATGGGCGTTGACATCAAGAGGTTTGTTTTTCAACTGTGCTGTGCTCCAGACAATATACCAGCTGAAGAGGTTGTAGCTGGCTTGCTTCAGTACCTGGATGATGACCTCATGGTACTCAATACAAGTGTCGTCAAATCTGTATTTGAAAGAATTCTTCATTACATTTGGGAAATCGTGGTTGAAAACTTCACTAATGGCATTAAAACCAACGCAGGGAGAACTGCAGCCTTCTACAAAAGACAAAACGAAGCACTCGAGATAGTGCAGGGTTTCTTTTTTGCCGACGGAGTTGGAGTGCCACTGGAACGTCTTCAAGTGGGGCAGTACAAGACTTTGATTGAAACCCTCACCTTACGCAAGTTGTCTACAACTGAACTAATCCAGCACTACTTTTCCGACAAGTGCAAGGAACAGGAAACTGTTGAAGAGAAATATGGAGCTGTGACATTTAAAGTTTTCTACGATTTTAACAATCAGAAGCTCCAAGTGGAAGTGTTGAATGCCAAGAACCTTCCACCGTTGGACACAAACGGATTGTGTGACCCGTATGTGACTGTGGAGCTTTTACCAGAGGAGTTCTTTGGCAAAGAAGTGAAGAAAACAGAGATTATCAAGAATGATCTGTTTCCTCTTTTTGACGAGCAGTTTGATTTTGACGTTGAACCCGAGTTGTTGAGAGAGACTGGTGCCTGTATACATATGACAGTCATGGACTATGACGTATTTTCAAATGATGATTACGCTGGTCACGTGTTTTACAACTTGAACAATATCCTGGGTTTGCGGGAAGTTGTAGCAGGAGGCTTTGCAAACGTACCACAACAAACACGAAATATCTTCCACCCCAAACCTCAAGGCCAGTACTTTGAAATTCTTGAGTCACGTGACGATGAAAAAGCACAACTATTCGCTAAAGCAGAGAAAGACTTGTATGAGAAAACCATCAGTGCTCATGTGTGA

Transcript

OS493_026667-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80TT2	BAI1-associated protein 3 OS=Mus musculus OX=10090 GN=Baiap3 PE=1 SV=4
O94812	BAI1-associated protein 3 OS=Homo sapiens OX=9606 GN=BAIAP3 PE=1 SV=2
Q9R189	Protein unc-13 homolog D OS=Rattus norvegicus OX=10116 GN=Unc13d PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002844 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06292 all species →	MUN	MUN domain	Repeat	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR052095 all species →	Family	UNC-13 domain-containing protein	Interproscan
IPR014770 all species →	Domain	Munc13 homology 1	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR010439 all species →	Domain	MUN domain	Interproscan
IPR014772 all species →	Domain	Mammalian uncoordinated homology 13, domain 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45999 all species →	UNC-13-4A, ISOFORM B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0099503 all species →	Cellular Component	secretory vesicle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15621	BAIAP3; BAI1-associated protein 3	-	Transcriptional misregulation in cancer	ko05202	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026667-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

86.8Max TPM

28.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.14	32.38
polyp at pH7 6	18	18	25.34	42.53
coral polyp · control treatment	16	16	32.42	86.76
coral polyp · oil and dispersant treatment	16	16	41.05	65.59
coral polyp · oil treatment	16	16	30.18	43.92
coral polyp · dispersant treatment	16	16	30.56	47.69
Polyp	10	10	13.13	23.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.28
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.26
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.83
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.70
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.69
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.61
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.51
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.21
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.88
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.28
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.73
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.70
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.60
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.85
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.89
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.93
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	86.76
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.51
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.76
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.12
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.76
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.53
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.05
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.31
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.37
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.12
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.81
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.73
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.59
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.26
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.51
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.00
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.99
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.49
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.09
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.26
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.03
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.67
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.56
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.17
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.92
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.65
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.05
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.61
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.78
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.34
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.27
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.45
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.63
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.45
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.66
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.17
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.27
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.71
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.23
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.55
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	23.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	15.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	14.77
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.47
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.83
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.32
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.53
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.79

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.