Gene detail

Detailed information of OS493_026706-T1 in Lophelia pertusa

Genomic Location: scaffold_139:548408...570281
NR annotation: KAJ7390196.1, Ankyrin-repeat and fibronectin type III domain-containing 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026706-T1

ATGTCTGAAGAGACGATAGCTTACACGGCAAAGCCTGTTTATAGATCCAACGAGACAACCTGCAGACGGATATCATCTACAACTGATGGGTTTCTTGTCCCGTCTGGTGAGATCGACTACGACTTTCCCATTCAACAAGACCTAAGCGGCCTACTAAGGAAAGATGGAATTAGTTATAGCGGCACTTTAGTAAATGGAATTGACGGCGATTTTTCATGCAACGAAACAAGCAGTTCGTTGCAAAAACCACATCCATTGCGCAGCCCAGTCAATAAACAGTCATTGCTGGCAAGGGCATTAACGGTTTCTTCCATCTCAGAGAATGCAAGCAAGTCTTTAGCAGCAAAAGATTGCAGGAATTTCTCCAAGGCTCCTCTTAAGTTAAAGTTTCCATTGTCTCCCAGAGCGGCAGCTTGGAACCTTGAAGAAGATGACGAGAGTGGGCTGGTTAGTGGAAGCACTGATGGAGCTCCTTTTGGATACACAACAGGAGGCTTATATTATTCTACTGATGTGCATCTTCAAACATTGCACAGCACATTGCAGGGTAATGAAGAGGAGATTACGACACCGACAGAGCTGGAAAAGAAGCAAAGTGGTTTGAAGCAAACAAGGATCAGCAGACTAGCACGGCGGCTTAGCCAAAGAAGAGAGAAAGGAAACGTAAGGAACCAAGGGAGATCACACAGTTTAGAAGATCTTGCATCACCTATAGGAACATCAACAATGCATGGAAGCAACAAATCACCAAGGTTACAGCGCACCATGTCAGTTAATCAACGTTCCTCTCCTCGTATGCGGCTTTCTGTCCAGGAAAATAGATTCAGTTTCAATAACCGAGATCTAAAAGACAAATCAAAGAAAAGAAGGGACACCAGTTTAGATGCTCTTGTTGATGCAATTGTCCGTAAAGAAACTGACGAAATTACAAATATTTTGGAATCAGAAGATGTAGACATCAATGGGGTTAATGATGATGGATTTGCACCTCTTGACGTCGCTGTCATGCTTGGAGTACTTCCCATTGTCAAAATGCTCTTGATGTATGGTGCTCAGGAAAGCTCAACATTACCATGTTCTTATCTTGGTAAGCATATAAACATGCTGTTGAAGGAAGCTGAGCTCAGAGTGGACGATCTCACCACAGCAGTGGTGCATGTCAGTTATACCGCATCTTCTGAAATAAAGGAAAATGAAAGACTCTTTCAAGAGTGGTTATGGAGGAAACACTTGCTTGAGCAAATGAAGAAAGGACTTTTAAAAATAGATCCACCTGACAAGCCAAGCAGTGTAACAATATCAGTTGCTTCTGAAGACTCGCTACTTGTTCGTTTTATTGAACCACTTTGTGAAAAAGTTATTGTATCTAAATATAAAATTCAATGGAGCAAGACCCTGGACTTCAAGTTATTGGAAGGGGAATATGTTCTTCATGATTTACGGTCCCTAGAGTACACAATATGTCATTTACAAAAGTCTGTATTGTACTATGTACGAGTTTGCTGTGGAAATCTCAAAGGCTTTGGTCCATGGCTGGAATCCAGTCCTCCGTGTGCAATGCCGTCAACATGGCATGAGGTGGATGACTCAAAACCTCGTTTTGAGGGGCGATTAAATGTCATAGATGATTTGTTTGGTCGGGTGTGGCAAAGCCATGAGGAGTTCTCTCCAGTTCGACCAATATTGACACACAGGCCACGTAGTAACACATTCAGTAATGAGACAGAAAGTGAGCATCTAAAAAGGGGTGTATACCTGGCTTCTCTGTTATTTACTGACGACGAGAAGCTACTTGTAACTTTGGATGAAAATATCCCGATAATTGAAGTGGATGATAACCACCCAAGTACCTTCCTTCAAGACTTCTGTTGGTTAATGAAGGTTGCATGTACTTGGAAGGATGTAAAAAAATTAAAGCAAGAAATTGAGAAAAAGTCATCATCAACATCAGTCCTGTTCAGATGTAAATTGCTCCAGGCTGCCGATACTCTACAGGGTGCTCTTGGCAAGCAAGATCTTGGGAGATTGCATTATAAACCTCTCAAAGATAGGAATGGCAGCACAGTGATTGTTGCTGTCAATTATGTCATTCATGCCAGTTCATTTAAGCCGCGTATCCTGTCTCTAAAGTGGTTGTCCTTAAGCAAGCTTCAGAAGAAAATTCACACAGCTCCACTTGGGTTACAGGATGAGTTGTTCTCTGCGTCAGAGATGCTTGTCTCCTCTGTTCAGGAAAAGATACATTACTACGAAAACAGTAAAAAGAATCTTGAAAGGGGTTTATATATTGGTTATCTGAAGCTCAGAACCTTTGTGGATGCTATTCATGTTGTGGTACAAGAGAACTGTCCAAATGTTCTGTCACATGTCAAAATACGAGATAACCCTAACGTATCAAGAGAAGAATGGCAATGGCTTCAAACACTGGACTCCCTCAAGGAGGGCACCCAGGAGCCATCAAAGACAGCACATGAATTTCAAGTGTTGGTAGCCAAAGCAGCTGAAACCTTAATGGAGAAAGTAGGAGTTAGTGAAGAGGCGTCAAAACTTCACAGAATATATGACCGAGAGGTCGTTGAACTCGATGAGAATGTGTCATTCATCATTGTGTTCCCGCCACCTGAGGAAGTGTGCAGTGCACCGGGACAAGTGGACTCTCTCACGCATCAGAAAGGCTACATCTCTCTATCTGTACAGACTTTTGAAATGATTCACATGTATACCTACCAGCAAGAGTTTATTTGTCATTATTCTCGCCTCTCGTCTGTTCTGGATATGGACTCTGTCATCTCGCAGCAGTTGCTTAGAGAGGCATTTTCATCACCCGAGGTGAAGTTAGCAAAATCACGACAAGAGCAACTGTTAGATTTCCAGCGGGAACTGGACGAGACGTGGCAAGGAATGCGTTGGATATTAGATGCACTTCACTATGCCAGGGATCGTCAAATCCGGGGTGGAATACCACTGGTTGAAGTGTTTGAATACTCGCTTTCTCATCCTGATGGCCAGTGTTGTGTGTGTTCGTCTGATTTGAAAGGAAAAATCCTCTGCAATGGACACAGTTCTTCATCCAGTAATAGTCCCAGAGAGGGCGTGGTTCAAATTCACACAGCAGGAGAGACCAGCCTTCCCCCTGGAGCCACAGTAACGCTTCATATAACACCCAGCACAAGAGCGGGTGAAGTGGTGAAGATGGTTGTACAGCAGCTTCACAAGAAATGCCAAGACAGAGACAAATCTGCCCGGTGGCACAACCTCTCCGAGCAAAAAATTAAAGACTTATGTTTAGTGGCAGTAATCGGCGGCCAAGAAAAGTGTTTTTAG

Transcript

OS493_026706-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8N957	Ankyrin repeat and fibronectin type-III domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ANKFN1 PE=1 SV=3
A0A571BF63	Ankyrin-repeat and fibronectin type III domain-containing 1 OS=Mus musculus OX=10090 GN=Ankfn1 PE=1 SV=1
A0A8M9QN10	Ankyrin repeat and fibronectin type-III domain-containing protein 1 OS=Danio rerio OX=7955 GN=ankfn1 PE=4 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002462 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_026706-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR003961 all species →	Domain	Fibronectin type III	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR000159 all species →	Domain	Ras-associating domain	Interproscan
IPR039269 all species →	Family	Ankyrin repeat and fibronectin type-III domain-containing protein 1	Interproscan
IPR036116 all species →	Homologous_superfamily	Fibronectin type III superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21437 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0000132 all species →	Biological Process	establishment of mitotic spindle orientation	Interproscan
GO:0005819 all species →	Cellular Component	spindle	Interproscan
GO:0061172 all species →	Biological Process	regulation of establishment of bipolar cell polarity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24478	ANKFN1; ankyrin repeat and fibronectin type-III domain-containing protein 1	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026706-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

14.6Max TPM

5.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.99	11.05
polyp at pH7 6	18	18	5.65	8.41
coral polyp · control treatment	16	16	6.83	14.55
coral polyp · oil and dispersant treatment	16	16	4.68	9.63
coral polyp · oil treatment	16	16	6.27	13.00
coral polyp · dispersant treatment	16	16	4.15	8.15
Polyp	10	10	3.21	7.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.73
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.14
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.12
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.50
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.41
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.36
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.34
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.65
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.23
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.27
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.65
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.84
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.49
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.51
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.44
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.35
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.21
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.89
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.43
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.18
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.79
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.70
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.34
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.30
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.11
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.35
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.96
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.63
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.76
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.06
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.40
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.14
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.73
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.17
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.24
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.14
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.06
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.74
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.36
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.04
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.29
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.08
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.96
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.94
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.63
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.35
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.02
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.89
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.62
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.56
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.29
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.21
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.08
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.45
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.47
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.70

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.