Gene detail

Detailed information of OS493_026721-T1 in Lophelia pertusa

Genomic Location: scaffold_139:705018...720055
NR annotation: KAJ7390211.1, Centrosomal protein of 95 kDa [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026721-T1

ATGGATTGTGATGATGGATCATTGGAGTCCGTGGATGATGAAGCATTTATAGCTATAGCAAATGAGTTGTTGGACAAATGCAACCTTCCTGGTAAAGTCTCCAGACTTGAGGAATGCAGCGACAACTTTTTTGTTGGAGTTTACAAAGGTCTCCTAGGTGATGAATTGCAGGGTATTATAGAGAATCCTATCTCAATTGAGCAACACATCAGAAATTGCCAAACTGTGATTGATTTGATCGCTGCTGATGTTCTTAATGTGGATCTCTCGCACATTTCTGGGAAGGCCATTGTTGAGGGCGACAAGGCTTCAATACGAAACTTTCTCGAGATCTTTGCTGGATTGCTGGAGTACTTCATGGAGTATGTTGATGATGAAGGTTCTGATGATGAAGACGACTCTAATCTGCTGACGTCAGATCATGATGTCATCTCTGGAGTATTAAGAGAAGAGTTTGGTCCTTCCTATGATGTTCTCTATGGGCCCAGGTCACAGATGAGCGGGCCAAGTAAATTTAGAGGGGAGGCACAGCAGGATAGAGTGCCATCTCGTCAGCCAAGTGGAAGAGGAACTAGAGATCCTAAGAGTAATGTCCAAGGAAGAACGTCGGCACTTGCTGATTCTGTTGCTTGGAATGCCACTGGCTTTGATGCCGACACCTCAAAGTTAAGTGACTCAAGAGTAGATGTCGTCAGCGACACAACAGCTGACCTGATCAGACTCGGAGAGACCCCGTCAGACAGAGTGCCTTCCAAGATGTCAGAGAGGAAAGAAACCAGAGATCATGTTCCAGACTCGACATCTGGCATGTCTGATGTATCTCCAATGATTGGTGTCCGCTCTCAAGAAGGTAGCAGGATTTTTAGTGATGATGTACATGTAGTTGGTGGTGTTGTGGATGGCAGAAGATCTATACAGGGTACTGGAAGGCTACTATTAAGGGATGCAGTTGCTCATTCCCAAAGATCAGACTCTACGGGGATTAGATCTGGATACACTGCAAGGAAGCCTGAGTCATCCAGCTTACTCAGTCGCGATGCCACTTCTGTAGAAGATGAGTTGACACAATACACTTTAACACCAACTGAGCTCAGGGATTCCCCAGCAACTAAGGATAAGGGCCCTGACAAACCTTCAGTCAGTTTTCTGTCCACATCCTCAACGTCTGCTGCATGGCCTGAGCAAATATCACCATTAGAACCTTCAAAGGACTCCATCAGTAGAGAGACAAGTGGGTTTGATGCACTGGGTGTGCGACCGAGACAGCCACCGGCTACAACTGGAGCTACAGACAGTGGGTCGGGGGACAGCAGTGGACGATCCACTCCTGTTTATCATCATTATCATCATCACTTTCATCACGCACAACCACATGGAAGAGTACCGGGATTTCAGCCTGTAGCAGGAGTCAGTGCAGCAACCACTGTTGATGTACTGGGTCCAACAAGCCGCCTGTCCAGGACTGAGCCTACTGCAGCGGCAATAGCGACTAGACCTGACTCAGGGGTAGCAGACAGACTGACCAGGACTGCCCCTGGAGCAATCACCCACCCCCACACAGTAGGTGTTTATCCTTCAGCAGCCCTTCCAAGAAGTACCAGTGGTGTGTCCAGTACAGGTGTCACTCAGCCTCCTGCTGCTGCTGTGACAGGGACGACATCTACTCTGACTGATTCAGTGTTTCTATCAGGGTCTGGATCATCTCGTCCTGTTGTCAGAGCGTCCAGTGCTGCTGGTTCAACTGATGTATTTCCTGGCACAGCATCCTTAAGAGAAAGACTGGCCAGGTCATTAATAACAACCACAGCCACTTCTACTGCAGGTTCATCTTTACCAGTGTCATCAACAGCACCATCAACTAGTTACAGACCTCATGACACACCTGGGAGCAGTTTAAATGATCGGACTTCAAAAACAGAACAAGCTGACTGGGTAGCGGATAGATTGAGCAGTTTAAGGAGAGGACAGCCATTAGCATCAACATTGCCTGCGAGACTTCAAACAGGAATCACAGATCTTGAACATCCAGCACTTCGCCGGTCAACAGCTGCAGAGCTTTTAGCAAAGTATACTGCACCGGAAGCTGAGGAGAGCGGCGGAAGTGAAAGTGAAAGGGAACCGGAAGACGAGGAATTAGCGCAGAACAGTGATAGCGCTGTTGATTATGGAAGAATCGAGCCTGTTGCTGCTAATTTGAGGATGACAAGAGATACTTCAACATCTCGACCGAGAAGTGGCGCTGGGAGAAGCACCAAGAGTCCAAGGACACTTCACAGCTACAAAGAATCGACTGAAGAAGATTCTTCTCCCGAACGCCTTCCTCGCCGCGGCGTAACGTTCCGTGACACGGTGGAGACGTTTCCTGTGTCAGGAAGAATGGATCGGCTAAGGCACCTGCTGTACGAGGAGGCTGAGGAGCAGCGGAAACAACACACTAAAGTCATGCGCAAGACTTACCGTGACCAGTTAAGGGAAATACAGCAGGAGAAAGAAAGAGAGAAAACTTCACAACACAAAAGAAAACTACCGCTATCCCCAAACGTCCCCAAGAAGAAGCCGAAGAAGAAGTCTCCAATCAAGAATCGTGGGAGACTGGAAGCTGTTTACCGCACACAGAACAGAAAATCCCGGCCAGTGAGAAAAACTGTAACAGTGAGAGGAAGAAAGAGAAGTGCATCAGCGAGCCCTGTACTGAGCACCAGGAGGGCAAGCGGCAGTCCGGATCACCCGGACATATTGCTTCCCGCCATGTTGGAAGAGTTCCCTTTCCTGCACGTCTCGCCCCAGACCGCCCACAGCATGTGGAACAAGCAGGCGCGGCACCTTAGCTCTGTTCTCAAATCTGGCGCTGAAGCTAAAAGGACCAAGACGCAGCGAATGATTGAAGAGGCTGAGAGGCGACAGGAAGCTTTGGTGGGAATATTAAAGAAAGATGTGGACCATAATCTGAGAATGCGAGAGAAGCAGGACCGACAACAGCAGCAGCGTACAGTCAGGGCAAAACTGAGAGAGAAACGCCAAGTATCTGCGCGTGCGCGACGGTACTACGATGAGTACGAACTGCGCATGCGGGCCAGGATGTTGAAACGGCGCACGCGTGAAGAACAGATCTTTAAAAGGTTGTTTGACGATGGTTTGGACATTCAGAAGCAACGTATACGCGAACTAAGAGAGTACGCCAAGGAAAAGAGAGAATCCCTGGCTCAGAGGCAGCAAAACGAAATCGAATCACTGGAAAACTTTTATCGTGACCAGTTCGCCATGCTGGCGGAAGGCATCGCTCGTGAGAGGTATGAGATGGAAGTGCGTGACAAAGCCCAGGAAAAGGTGGTCCGACAGATGCGAGGGGAGTTACGTCAGAAGCTAGAGCATGACGTGAAAGAATTCCAAGAAAACCTCCAGCGCGATGAAGATTCGGCGTACTTCAGGCAGCTGGAGGCTGATAGACTACGAGGCAAATTTCAACTGGAAACTCGAAACGCATTCTACTAG

Transcript

OS493_026721-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BVV7	Centrosomal protein of 95 kDa OS=Mus musculus OX=10090 GN=Cep95 PE=1 SV=2
Q5XI03	Centrosomal protein of 95 kDa OS=Rattus norvegicus OX=10116 GN=Cep95 PE=2 SV=1
Q96GE4	Centrosomal protein of 95 kDa OS=Homo sapiens OX=9606 GN=CEP95 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003844 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19016 all species →	DUF5745	Domain of unknown function (DUF5745)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR044039 all species →	Domain	Domain of unknown function DUF5745	Interproscan
IPR026619 all species →	Family	Centrosomal protein of 95kDa	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22545 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000922 all species →	Cellular Component	spindle pole	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16544	CEP95; centrosomal protein CEP95	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026721-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

20.5Max TPM

5.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.75	8.68
polyp at pH7 6	18	18	5.41	7.36
coral polyp · control treatment	16	16	6.03	20.53
coral polyp · oil and dispersant treatment	16	16	4.00	20.10
coral polyp · oil treatment	16	16	5.71	11.37
coral polyp · dispersant treatment	16	16	3.52	9.14
Polyp	10	10	6.57	12.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.68
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.79
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.23
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.64
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.22
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.04
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.13
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.26
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.75
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.26
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.70
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.83
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.20
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.16
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.95
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.25
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.53
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.39
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.61
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.41
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.31
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.10
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.51
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.81
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.68
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.54
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.55
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.24
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.37
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.66
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.40
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.13
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.32
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.02
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.13
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.95
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.61
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.91
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.79
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.05
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.20
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.61
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.19
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.21
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.32
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.68
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.02
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.01
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.95
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.89
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.77

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.