Gene detail

Detailed information of OS493_026789-T1 in Lophelia pertusa

Genomic Location: scaffold_140:330413...359915
NR annotation: KAJ7383604.1, Ubiquitin carboxyl-terminal hydrolase 47 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026789-T1

ATGGTCAATGCAACGTCCAAAGAGGTAGTCCCTGTAGAAAATGATTGCCATACCGACGAACCGACAGTTTTGTGTATCGTAAAAGACGCGACCACTGTCGACTGGAAAAACAGCAGGCATACGGTCAATCTACCGGCATCTACTCTAGTGAAAGAACTGTACTGTCATGTTGCTAAACAGGTCAACTATGTAGAAGACACTTTCGATTTAGTGTGGAGTAAAAGCCTGGAAGACGGCACCGAAGAGATTGTACTAAATGGCGAAAAGACAAAAACATTACAAGAAATCGGGCTGGCGGCCAACGGCAAAAAGAACAATTTCTTAATCAAAGATAAAGATGGAGTGCAACCAAAGAAAGCAAAGGATGAAACAGATGAAACGATTACGGAAAGTGTCTCTAACCTGTTTCAGAGTAATACCAGCAGTTCGTATTATTCCTCCAGTGACGGCTACACCTTGGGAAAGTCAGAAACAGGATTTGTTGGTCTTGTGAACCAGGCCATGACATGCTATCTGAACAGCCTCCTACAGACACTGTTCATGACCCCAGAGTTTAGGAATGCTATTTACAGGTGGGATTTCACTGGAAGTGAAGAGGAAGCATCCAAGAGTATTCCTTATCAGCTTCAGAAGCTGTTTCTTCATTTACAGACAAGTTCCAAGAGAGCTGTAGAGACCACTGATGTTACCAAGAGCTTTGGATGGGACAGTAGTGAAGCATGGCAACAGCATGACGTACAGGAGCTCTGTAGAGTCATGTTTGATGCTTTGGAAAGCAAGTTCAAAAAGACTGATCAGGATGATATCATCAACCAACTGTATCAAGGAAAACTCAAGGACTATGTGAAATGCCAACAGTGTGGTCATGAAAGTGCACGGACAGACACTTATCTAGACATCCCTCTGGCAATCAGGCCTTTTGGATCAAAGCATGGATTAGGCAGTGTGGAAAATGCCTTGGAGGATTTTGTCACTCCAGAACTCCTGGAAGGTACAAATCAGTATTTCTGCGAGAAATGCGACAAAAAATGTGATGCACACAAGGGGTTGAAATTCTTTACCTTCCCTTATCTTTTAACCTTTCAACTGAAGCGGTTTGCATTTGACCATGCAACACTTCATAGAGTCAAACTGAATGACAGGATGACATTCCCAAAATATCTCGACCTGAAAGACATTGTAAGCAAGGAATTGGAAGAGAATGGTGCCAATGAAGATGCCAGTCTGAAAGGGGATTCCCCAAGCAGCACAGAGACTGACAGTGGGGTAAGTGAAGGCTGTTCTGATAACGGCATGTCCACTGGAGATGAAGACATGGACAATGCAAATACAGGAATCAATAGAGTGGACGGGACCACTGGAATGAAGAAAGTGGAGCTGACTGAAGACTTGTTAAACAGTGGCCTGGCACAGAACATGAAGGGTCCATATTGGTACGAGTTGTTCTCAATAATGATTCACTCAGGCAGTGCATCAGGAGGACATTATTATGCTTACATCAAATCCTTTACAAATGGGCAGTGGTATTGTTTTAATGACCAGAGCGTGTCAAGGGTATACGATGATGATATTGAGCGTACTTATGGAGGACTTGAATCATCCAGAAGCTACTATTCATCAGTATATTCAAGCTCCACAAATGCATACATGCTGATGTACAGACAGGTTTCTCCTGAGAGAAATGCTAAGTTCTTGGATCAATGTGATGTACCTACCCACATAGTGGATCTAATGTACAAACTGCGACACCAGGAAGAAATGGAAAGAAGGAGAAAAGAAATGGACAGAAGCTTGTGCAAGATCAAGATTTTTTGTGAGCACCCCGTCAGCAAGAGAATGATGGAACGCAAATTGGAGATTCATAAGGATGACACATTGAAAGCAGCAATATCCATTGCTCATAAGCTGTTCCACTTGGAGAAGGTTTTAACAGCTGAACAGTGCAGAATTGTCAAGTATGATGACTATTATGACTACATTGAGAGATCATTTGATGGTGAAGAGCAAAATTCGATGAGCAAAGTGCTCTGTGGTGTTAAACAGTCTTACATATTCGACCTTCTCCTTGAAACAAGAATGCCACATGAAAGATTTTTACCCTACAAACCCGGAGGAACAACAGTCAAAGTTCACATTGTAGATCTGGAAAATGAGAGAGTCGCTTCATATGTAAATGTGCGACCATTGCTCAGTTCAACTGTTAAGGATCTTCACACTCTAATTCATGAGAAATTCAAACTTCCTCTGGATTGTATGAGAATTGTGTTTGAAGGAGCATACAATGATCTTAAGCTGCTGGACAGCCCTAACAAAGTATTAAAAGAACTTGGATTCTTCAAAAACAACAGGGTTTTTGTGGAAGCCTCTAACAGGGAGGCAGAGTTTCTATTTAAAGACTCAAGAATGTTTAAAATCTTAGATGTGTATCAGCATACTATCCAGCTGTGCGTCATGTTGCCAGATCCATCCAGAAAACCATCAGAGCACACAAGTAGGTATATCTGCGAGGCGGCAGTTGATTCTGAAAAGACTGAAAAACAAAGAGAAAAAATTGTTCCTGTCGACAAGAGAATCACCCTTGGAAAGCTGAAGGAAATTCTCAAGAGTGATGTAGGATGTTTGCCAGAATTTTTTAGGGTTTACAGAGTTTACTCAAACAACCAAGAAATTGAGTACAGCAAGTTAACTGACCCACTGACAAGCTTCAATGATGATTCTAAGGTGCGAGTGAAGTACAGTCGTGCTCTCAAGAAAGGTGAACATCAACTGAAAATATTCCTGCTGAAACCCATCGAAAAGGAGCCTTTTAAGTACTTTTGTGACTGGATTGTCACTGATGGCATGACAGTAAAGCAGTGCAAAGAGCTCTTGCAGCCAGAAATCTGTCAAAGATGTGGTATTGATGTCCCAGTTGAAAATCTGAGGATGCGAAGAAAAAACTGGAAAAATCCTGGCACAGTCTATGTTGACAGTCAGGTTTTTGAAGAGAACATTCAAGTGTATGCAAGCTTTGAAGTGTTTTTGGAAATACTAGAAGGTCCCGAGAGAATGACCTCAACAGATCAGCTGTCAATCTATGTACGACATTGGCATCCTTCAACAATAACTCTGGACCTTCCAAAAGAAGTTGTTTTGCAGGATAGTGTGGTTGAAGAGTTGAAAGATGAAATAAGTAAACTTAGTAGCATTCCAGTGGAGAATTTAGAGTTGTGCAAGGGTCGTGGACAGTTTCCCTGTGAAGTGCCAATTCTGGAGATTCATGATGAGTATGACTGGTCAAGTGATATGACATCCCTCGGAGCAAGTCCTTTGCTAGTTAATGATGATGGAGCAGTGTTATTTTACAGAGATAAAACAGAAAAACTCATGGAAATAACGGAAGAAAAGAAAAAGGAAATCATGAAAAAGGAAAATGCCAAGACCAACAGCTCAAGCATGAGGACTGGCAGATTTTCATACAAAGAAAAAGCTCTAAAAATTTATACAGATGATGATAGACCAAGCAAATGA

Transcript

OS493_026789-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E1C1R4	Ubiquitin carboxyl-terminal hydrolase 47 OS=Gallus gallus OX=9031 GN=USP47 PE=3 SV=1
Q96K76	Ubiquitin carboxyl-terminal hydrolase 47 OS=Homo sapiens OX=9606 GN=USP47 PE=1 SV=3
Q5U252	Ubiquitin carboxyl-terminal hydrolase 47 OS=Xenopus laevis OX=8355 GN=usp47 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003814 (this species only)
Ubiquitin family	ULD\|UFD/UBQ\|UBQ_Other · all ubiquitin genes in this species
Ubiquitin family	ULD\|UFD/UBQ\|UBQ_PIM · all ubiquitin genes in this species
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan
PF19718 all species →	USP47_C	Ubiquitin carboxyl-terminal hydrolase 47 C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR045578 all species →	Domain	Ubiquitin carboxyl-terminal hydrolase 47, C-terminal	Interproscan
IPR050164 all species →	Family	Ubiquitin carboxyl-terminal hydrolases	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24006 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11857	USP47; ubiquitin carboxyl-terminal hydrolase 47	EC:3.4.19.12	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026789-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

89.4Max TPM

31.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	26.46	46.35
polyp at pH7 6	18	18	26.11	42.26
coral polyp · control treatment	16	16	42.79	89.41
coral polyp · oil and dispersant treatment	16	16	37.69	53.26
coral polyp · oil treatment	16	16	34.10	52.05
coral polyp · dispersant treatment	16	16	31.69	50.77
Polyp	10	10	14.64	25.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.91
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.73
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.29
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.90
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.76
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.49
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.47
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.97
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.17
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.16
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.49
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.08
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.68
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.09
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.91
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.57
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.41
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.98
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.61
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.38
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.18
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.41
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.38
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.60
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.56
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.21
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.71
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.40
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.83
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.24
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.32
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.79
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.64
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.34
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.26
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.76
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.97
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.47
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.41
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.16
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.98
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.27
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.62
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.43
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.77
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.12
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.03
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.93
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.88
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.78
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.58
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.72
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.81
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.77
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.88
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.71
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.79
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.50
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.73
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.41
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.29
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.67
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.18
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	25.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	23.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.17
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.21
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.53
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.04
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.78
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.19
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.04

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.