Gene detail

Detailed information of OS493_026847-T1 in Lophelia pertusa

Genomic Location: scaffold_140:890279...909851
NR annotation: KAJ7383661.1, hypothetical protein OS493_026847 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026847-T1

ATGGATAATACAGACTCTGGCTCGGTTTGTATCAATGTAGGGGATGTTGAGGATGACATCTTTGATGGCAGCGTCACTTTCCATCCTGAAGATCACAAGAAAGGAGTGTTTCTGGCTGGACTGAAAGTCACTGCTACCATTATTGATGTGGAACGTGCACCAAGAGCTCATCCATTCAATCCTAACTTATACACCATAAAATTGAGTCATGGCAGCTTTACCTGGGTGATCAGACGTCGTTATAAACACTTCCTAAAACTAGACGCGGAACTGTTTCTTCACAAAGTGAATGTGCGCCGACATAGTATAACAGAACATATACGGGACCACAGGGGAGAGCAGTGCCATGTTCACTTGCCCAGTCGCCACTTGCCTAAGCGACCTGACATGTTTGCTACGACACCCAACATGGAAAAGAGAATAAAATCACTGGAGAAGTACCTGCAGGTGATTCTGGACAGCCCAAACTATCGGAATCACAAAGAGACACTGAATTTTTTGGAGGTCAGCCATCTGTCCTTTCAGTTTGATTTGGGGAACAAAGGAAGGGAAGGCATCCTGAGAAAGCGGGCAGGAGGCCATAGGTTTCCAGCAGGGTGCTGCAGTTGCTGTGCAGGTCTGTCATGGGGAATATGGGACAAGAGGTGGCTCCTTGTGAAAGATAGTTTTATTGCTTATGTCAGCCCAAAGGATAAACAAGTCAGAGGAGTTGTGTTGATGGACAGAGAATTCACCTTCAAGTATGGAAGGAAACAAACAGGAGTACGACATGGCTTGCTGGTCCATAACCAGGCAAGACAACTGCTGTTATCGTGTTGGACTGAAAGGAAGGCAAGTGAATGGATGAAAGCCATTGTTCAAGTGATGGCAACGACTGGTGCTGAGTGGATAAAAGAACATCCTCACGGTTCATATGCTCCTGTCAGGGAAAACGCTTGTGCTCAGTGGTTTGTAGACGGAGAGTCGTACTTTGATGGCGTGGCCGACGCTTTAGAATCTGCACAAGAAGAAATCCTCATAACTGGCTGGTGGGTCAGTCCAGAGATCTATCTTCGCCGACCAATCACGGCTGGCCATGAGTGGAGACTGGACAATATTTTGAAGAGGAAAAGCGGAGGATGGAGTGAAGCCAGACTGATGAGTTTACACCCAAACATAAAGGTTTTGCGCCACCCAGACCACATTCCTGGGACAGGTATTATATATTGGGCTCATCATGAAAAGTTGGTGGTTGTGGACCAGAAAGTGGCTTTTATAGGAGGTCTTGATCTTTGTTTTGGTCGTTGGGACAACTATTTGCACCATCTGACTGACTTTGGATCTGCGGTTCGGCCTCCGACCATCAACAAAACGGAGCAACATATCAGGAATATTGGCGCCATGTTTGTAGAGGGAACAGTTGAGGGACTGAACTTGCCTGTTTCTCCAGATTTAACAGACGCAGGAACTTCTAGAGGAAGCAAAATGTGGCTGGGAAAGGATTACTCGAATCCAATCACCAGGGACTTCTTTGACGTCAACAAACCCTATGAAGACTCTGTGGACAGAGGCTCTGTTCCTCGCATGCCGTGGCATGATGTTGGTCTGAGAGTGTATGGCGCACCCGCAAGGGACATCGCCAGGCATTTCGTTCTCAGATGGAATGCTACTAAGATTGAAAAAGCTAAAATGTATCCTGACATCCCTTTTCTGCTTCCGAAGTCATACGCAAAACTTACAAATGAGAAGCCGGCGGCATCACACAGCTCTAACGTGGTGGATTGTCAAATTCTCCGTTCTCTGTGTTCGTGGTCAGGCGGTGTACCAGTAGAAAGTTCCATTCACGAGGCGTACATCAAGGCTATTGAAGCATCTAAGCACTTCATTTATATCGAGAACCAGTTCTTCATCACTTCTCTGTTCATTGACAGTATCAAGAATGTGATAGGTCAGAACCTACTCTGGAGAATAGAGAGGGCGCACAGAGAAGGGGAGAACTTTAAAGTTATAGTCGTTATGCCGCTTCTACCAGCATTTGAAGGGGAGATTGGTACAGCGACTGGTCGATCAATTGGAGCCATTACTCACTGGAACTACAGATCTATTTGCCGTGGATCTCATTCCCTGCTGGAGAGACTAGCGGAGCTTGTTGGTGACCCCTCCAAGTATATATCATTCTATGGACTGAGAACTCATTCGGAAATACATGGAACGCCCATAACAGAGCTAGTGTATGTTCACAGCAAGATGATGATTGTTGACGACAACACAGTTATCATTGGTTCAGCTAACATCAATGACCGCAGTATGCTGGGGAAGAGGGATTCAGAAATAGCTGCTGTTATAAAGGACAAGGAATTTGTGCCGTCATTATTGGACGGTGAAGAGTACCAAGCTGGGCAGTTCGCCTTCAATCTGAGATCAAGGCTCTTCAGAGAACACCTTGGTTTATTGGACTCTCCTTCAGATGAAGACATCCGAGATGTTGTTTCAGACAGTTTCTATGAGGATGTTTGGATGGCTACAGCGAAGAAAAACACTGAAATTTACGATGAGGTGTTCCACTGCATGCCAACCGACCATGTTCGTTCATTAAGCGATTTGAATGCTTACAAGAATCTTAAAAGCCTTGCCGCTGAGGACCCTGGAGAGGCACGTGCTCGTCTGAGAGGCGTCAGAGGGTACCTAGTTCAACTACCCCTTCACTTTTTAGAGAAAGAGGACCTTCGACCTCCAATTGGCAGCTCGGAATATTTTGTTTCAGATGGAGTCTTTACGTGA

Transcript

OS493_026847-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O08684	Phospholipase D1 OS=Cricetulus griseus OX=10029 GN=PLD1 PE=2 SV=1
Q9Z280	Phospholipase D1 OS=Mus musculus OX=10090 GN=Pld1 PE=1 SV=1
P70496	Phospholipase D1 OS=Rattus norvegicus OX=10116 GN=Pld1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001609 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00787 all species →	PX	PX domain	Domain	Interproscan
PF00614 all species →	PLDc	Phospholipase D Active site motif	Family	Interproscan
PF13091 all species →	PLDc_2	PLD-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001736 all species →	Domain	Phospholipase D/Transphosphatidylase	Interproscan
IPR036871 all species →	Homologous_superfamily	PX domain superfamily	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR001683 all species →	Domain	Phox homology	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR016555 all species →	Family	Phospholipase D, eukaryotic type	Interproscan
IPR025202 all species →	Domain	Phospholipase D-like domain	Interproscan
IPR015679 all species →	Family	Phospholipase D family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18896 all species →	PHOSPHOLIPASE D	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0035091 all species →	Molecular Function	phosphatidylinositol binding	Interproscan
GO:0004630 all species →	Molecular Function	phospholipase D activity	Interproscan
GO:0006654 all species →	Biological Process	phosphatidic acid biosynthetic process	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0009395 all species →	Biological Process	phospholipid catabolic process	Interproscan
GO:0043231 all species →	Cellular Component	intracellular membrane-bounded organelle	Interproscan
GO:0060627 all species →	Biological Process	regulation of vesicle-mediated transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01115	PLD1_2; phospholipase D1/2	EC:3.1.4.4	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026847-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

27.0Max TPM

10.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.54	22.12
polyp at pH7 6	18	18	13.04	26.96
coral polyp · control treatment	16	16	11.27	21.00
coral polyp · oil and dispersant treatment	16	16	8.23	18.92
coral polyp · oil treatment	16	16	10.43	15.34
coral polyp · dispersant treatment	16	16	7.45	17.18
Polyp	10	10	10.26	17.26

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.12
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.17
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.09
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.88
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.53
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.63
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.12
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.88
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.91
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.68
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.42
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.80
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.07
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.96
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.39
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.80
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.31
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.89
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.52
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.35
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.73
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.08
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.81
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.53
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.95
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.61
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.04
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.50
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.42
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.70
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.92
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.73
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.02
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.93
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.66
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.81
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.43
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.22
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.33
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.28
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.16
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.53
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.95
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.51
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.40
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.95
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.74
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.57
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.68
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.18
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.01
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.76
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.22
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.70
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.60
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.38
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.20
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.61
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.52
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.23
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.27
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	17.26
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.86
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.75
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.83
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.77
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.