Gene detail

Detailed information of OS493_026927-T1 in Lophelia pertusa

Genomic Location: scaffold_142:283242...301300
NR annotation: KAJ7371283.1, SWI/SNF- matrix-associated actin-dependent regulator of chromatin sub A-like protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026927-T1

ATGTCTTCTGGAGGTTTGACAGAGGAGCAACGAAAGAGGATCGAAGAAAATCGCCGAAAAGCTCTTGAGAAACGAGCGGCTCTTTCAAGTAAACGACAGCAGAACAATTATGCGCCGACGACAACTTCGTCAGCAACACACAGAGGCGGAGGCGATGCGGGTAAATTTGCTACGAATCGCGCCGTTAAACCCTCAAGAGAAGAACATGGCTTGTTTTCTGCGAGCAAAGATAAAACGAGCGGACCACCAAGGCAGCCATGTTTGCAATCTGGAGGAGATAAACCGAGCTCAAATCTGAAGTCGGTTGGTCATGCATCCAACTCGTACATGTACACAAATGGTCACGCAAAACCTCCTTTGGTTGGTGCAAGTGTTAATTCACAAAACGCTACAGTAGGTTCTACGACATCAGTATCTAAACCCTCAAACGGACCAGCTTCATTGAACTCTTTTCAAAATACAATCTCTAAATTTTATCGCCCCCAGAACGCTTCCTCTTTACCCACAAGGAAATTCGAAACTGATACTCAATCTACATGTAATTCCAACTCGTCAACGACAACTACTTCGACATCAGTATCAGCGAGTAACAGAGCAGGACCTTCAAAATCCAGTGCTGCGCACAACTTGAATTTCAAGGGCAAATCAGAGAAACCAGTGAAAGGGAACTGTGTGTTGATCAGCAGACAGAGATTCACAGTCGTTGCACCATATCAGGCTCAACTCATTGGGATTTTTAAGACCATACCAAGCAGGAGTTACGATGCAAAGACATTACAGTGGGATTTCTCTTTGTCAGACTATGACAAGCTCATGCAAGCAGTCCAGTCTTTACCTGCGCATATTACTGTAGAAGGATTATCAAAAGCTGTGTCAGCAACATTTCTTAAGGCCACCCCTGGCACTCTAAAGGAAATGTCAACAAGTGACATAAATTTAAACTCAGTCGATCACAAGCTTGTTGGAGCACTGATGCCATTTCAACATCATGGAGTCAGTTTTAGCATCCGTCATGATGGCCGAGTGTTGATAGCTGATGATATGGGCCTGGGAAAGACAATTCAAGCGATCTGTGTTGCATGTTACTATCGACCTGAGTGGCCTCTCCTTGTCATTACGCCGTCCTCTCTCAGAATAACCTGGAAACAGGCTTTTATCAAATGGCTTCCCTCTGTGGACCCAGAGTACATTAATGTTGTCCTGACAGGAAAGGACAATCCCACAGCTGGGCTTATCAACATTATCAGTTATGACCTCTTGTCTAAATGTATGGAGGATTTGAAAAAGAAGCAGTTTAGAGTCATCATAGCAGATGAATGTCATTTTATCAAGAACTACAAAGCCTCAAGAACTCAAGCTGCCTTGCCCCTGCTAAAGGCAGCCACTCGTGTGCTTCTTTTATCCGGGACTCCAGCTCTGTCACGGCCGCTGGAGCTCTACACACAGATCCGCGCCATTCGACCAGGATTGTTTCCCACTTTTCATCAGTTTGGAATCCGCTACTGTGCTGGACAACAGAATCGATTCGGCTGGGATTTTTCAGGAGCTTCTAACATGCAGGAACTTCAGCTCTTACTGGAAGAAAATTTAATGATCAGACGATTAAAGAAAGACGTTCTTTCCCAACTGCCTTCCAAAAGACGACAAATGGTTATGTTGGATCCATCGCTTATTAAGACTAAAACTTTGGAAAGTGCTGCTAAGGAAGTCTCAAAAGCTAAGCAACAAGAACAACACGGAGCCCTACTCAAATACTTCTTTGAAACTAGCGCCTGCAAGATTCCAGCGGTCAGGGACTACATTCTAGACTTGTTGGAAAGCGGACGGAAGTTTCTAGTTTTTGCTCACCACAAAAACATGCTGGACGCCATCTGCAAGTGTCTCACTCAGAAGAAGTACAGTTTCATACGCATCGATGGCAGAACACCAGCAGCAATCCGTCAGAGCTTGTGCGATCAATTTCAGCAAAACAAGGAGTGCTTAGTAGCCGCCCTCTCTATCACTGCCGCTAATACAGGTTTAACTCTTACCGAGGCCAGCGCGGTCGTATTTGCAGAGCTCTTCTGGAATCCTGGGGCTCTGGTCCAAGCTGAGGACCGTGTGTACAGAATTGGTCAAAAGAATGCGGTGAATATTCATTACCTTGTGGCTAAAAAGACCGCAGATGACTATCTTTGGCCATTGATTCAAAACAAGCTGGAAGTGCTGGGTAAAGCGGGTCTTTCCGAGGATGTGTTGGAGGCCGACTGTACATTTTTTAAGGACCCAAAACAACAGACGTTATTTTCATTTGTCGAGTCTTTCGTGGAGGATTACGCGGACGATAAGTCAACAAAATTGCTCGACACTGTGGCCTCTACATCTTCTGACAATATTCCAAACTTGGAAACCGACGCGAAAGCCTTTTCCATGGAAACAAAGCAATCGAAAGATGTCAATTCTACAAGCGGAAGTGACGCAAGAAAACGGACGAAGCCTGAAGGAGATACTGCAGAGACCGGAAGTGAATTTTCTGGTGTCATTGATGATAATTTTGATTGGTTTGATGGACTAGGAGATGACGATATCATTTGTGATGACCTGCAAGATGATATCACCAGCTGTAACAACGTACAGTTTCAATCAAGTTCTTCAAATTCAACCGAACCTTCTGCTAAGAGATACCGGTGGTGA

Transcript

OS493_026927-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q498E7	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 OS=Xenopus laevis OX=8355 GN=smarcal1 PE=2 SV=1
B4F769	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 OS=Rattus norvegicus OX=10116 GN=Smarcal1 PE=2 SV=1
Q0P4U8	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 OS=Xenopus tropicalis OX=8364 GN=smarcal1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001424 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00176 all species →	SNF2-rel_dom	SNF2-related domain	Domain	Interproscan
PF07443 all species →	HARP	HepA-related protein (HARP)	Family	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000330 all species →	Domain	SNF2, N-terminal	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR010003 all species →	Domain	HARP domain	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR049730 all species →	Domain	SNF2/RAD5-like, C-terminal helicase domain	Interproscan
IPR038718 all species →	Homologous_superfamily	SNF2-like, N-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45766 all species →	DNA ANNEALING HELICASE AND ENDONUCLEASE ZRANB3 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0140658 all species →	Molecular Function	ATP-dependent chromatin remodeler activity	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0031297 all species →	Biological Process	replication fork processing	Interproscan
GO:0048478 all species →	Biological Process	obsolete replication fork protection	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14440	SMARCAL1, HARP; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1	EC:5.6.2.-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026927-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

8.9Max TPM

2.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.95	2.87
polyp at pH7 6	18	18	2.93	5.74
coral polyp · control treatment	16	16	3.37	7.75
coral polyp · oil and dispersant treatment	16	16	3.68	8.92
coral polyp · oil treatment	16	16	2.47	5.18
coral polyp · dispersant treatment	16	16	2.02	5.36
Polyp	10	9	1.15	1.96

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.87
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.50
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.95
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.90
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.67
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.09
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.58
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.06
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.55
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.88
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.16
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.75
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.95
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.23
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.70
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.11
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.83
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.92
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.05
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.32
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.42
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.88
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.18
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.62
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.22
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.70
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.15
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.99
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.75
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.50
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.36
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.99
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.54
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.30
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.92
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.26
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.66
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.06
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.51
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.50
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.15
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.14
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.95
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.58
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.