Gene detail

Detailed information of OS493_026950-T1 in Lophelia pertusa

Genomic Location: scaffold_142:651195...699177
NR annotation: KAJ7371306.1, hypothetical protein OS493_026950 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026950-T1

ATGGAAATGGAAGCACCCAAAAAAGGATGGATGCAAAGAGCGAAGATCAAGGTTAAGAAAATTAGAGGTCGTGGAATACGAAGGTATCCAGCACATGATGAAAGAAATGGAGGACATGAGACCCGTGAAAATCCAAATCCAGTCGCACCCATTTCAGCAATGCGTAATGGAATTTCTCTTACCAATGAACCACCCAACACAGCCAATCCTGGCAGTGACAGTACTGTTTATCTACCCAAGCCACAAGAGGATGAGGGTGCAAGCCCCTCTAAAGAACCACCTAACAGCCAGGATTGTGGCAATACTGTTGATCTACCCAAGCCACAGCAGGCTGAGGGTGCAAGCCCCTCTAAAGAAGTCTGCCCAGCAAGTGTAGGATGCCCATACAATGCTGATCAAACATTTACAACCAAAAACATTTTTGGAAGAAACTATAAGTTGTTTGCTGACAAACTGGGATATAGCTATCAGGACATCCAGTATCTTGAAAGTAAGGACAAACCTGTACAACAAATCATTGAGGAAAAAGGAGACAGAACAATTGCTGAATGGATATCACTGTTAAAAGATATGGAAAGAAAGGATGTGGCAGAGGATCTTGAGAAATTCATAGAGAAAACCCCTACTCCAAGGCAGTTAAAACTGCGAAAAAAGTTACGTGAAAAGAATAAGGAACGGAAGACCTGTCGGGAATCTTACGATGCATTTATTTGCTTTGGCAATGAAGATAGAAAGTTTGTGGACAAAGTGTTAAAAAAATTGGAGAGTGCACCTTACAATCTTCACTTTTGTTCAAGTGAACGGGACTTCCTTCCAGGTGGCTCCGTTTTTGAAACAACTGCTGTGGCCATTGAGAAAACATGTAAAAAGTTTGTGGTTATCTTGTCAAGTAATTTTGATCACAGCGAAGGAGCTCACTATGAGTCACAGATTGCCACAGGTCTTTCACCAGGGGCCAAAGAGAAACGTCTTATCCCAGTTCTTATTGAAGAGGCTTATAGATCTAAGATTCCACGCACTATTTCTCATATCACATATCTTGATTACCTTCGACAAGATGAGAAACACTTCTGGGACTTACTAGCGCAGTCACTGGGATGGAGCGCAAAGTCGTCATCTGTTGGTTGCCGACGGCTTAGAACCTTATGCAGACATCTGAGGATGTCATCCACCAGTGCAGAAACGGATGCTGAGGTATTACTTGAAATCAAAAACAAAGTTGGTGTGATCACACTGAATCGTCCAAAGGCATTGAATGCTCTGAATTTAAACATGATCAGACAAATGTATCCAGTGTTACAGAAATGGGACGTTGATCCAGCTGTGAGCTTAGTTCTGATTAAAGGAACAGGAGATCGTGCCTTTTGTGCAGGCGGCGACGTCAGAGCAATTGCAGAAGCTGGAAAAAAGGGTGACAGCCTTACTAAGGTGTTCTTCAAAGAGGAATACATGTTAAATTATGCCATAGGAACACTGCAAACTCCTTATGTGGCATTTATAAATGGAATTACAATGGGAGGAGGTGTTGGTTTATCTGTCCATGGCCGATTCCGAGTTGCCACAGAGCGCACAGTATTTGCTATGCCAGAAACAGCTATAGGTCTCTTTCCTGATGTTGGTGGTGGTTATGCGTTACCCAGAATGAAAGGAAAGTTAGGTCTTTACCTTGCTTTAACAGGTCACAGGTTAAAAGGTTATGATGTTAAACATGCTGGAGTTGCAACACACTTTGTCACCAGTGAAAAGCTAACAGACTTGGAGTCATCATTACTCAACCTTACTGATCCACAATTGAACAGTGTACAAGATGTCTTGGATGGCTATGACAAAACGGAGGATAATGATTTTTATGAAGGAATAAGAGCTGTGTTAGTGGACAAGGATAACAGCCCTAAGTGGAAGCCAAGTACTCTAGATGGCGTGTCGAAGGAAAAAGTGGATAGCTACTTTGAAACTCCAGAGACAGAGAGCTTGTTCTTTGACATAACATCAATCAACTGGGGTGAAAGACAAAGGTTTTGA

Transcript

OS493_026950-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q58EB4	3-hydroxyisobutyryl-CoA hydrolase, mitochondrial OS=Danio rerio OX=7955 GN=hibch PE=2 SV=1
A2VDC2	3-hydroxyisobutyryl-CoA hydrolase, mitochondrial OS=Xenopus laevis OX=8355 GN=hibch PE=2 SV=1
Q5XIE6	3-hydroxyisobutyryl-CoA hydrolase, mitochondrial OS=Rattus norvegicus OX=10116 GN=Hibch PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003574 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00531 all species →	Death	Death domain	Domain	Interproscan
PF16113 all species →	ECH_2	Enoyl-CoA hydratase/isomerase	Domain	Interproscan
PF13676 all species →	TIR_2	TIR domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035897 all species →	Homologous_superfamily	Toll/interleukin-1 receptor homology (TIR) domain superfamily	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan
IPR032259 all species →	Family	Enoyl-CoA hydratase/isomerase, HIBYL-CoA-H type	Interproscan
IPR000157 all species →	Domain	Toll/interleukin-1 receptor homology (TIR) domain	Interproscan
IPR000488 all species →	Domain	Death domain	Interproscan
IPR045004 all species →	Domain	Enoyl-CoA hydratase/isomerase domain	Interproscan
IPR029045 all species →	Homologous_superfamily	ClpP/crotonase-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43176 all species →	3-HYDROXYISOBUTYRYL-COA HYDROLASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003860 all species →	Molecular Function	3-hydroxyisobutyryl-CoA hydrolase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006574 all species →	Biological Process	valine catabolic process	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026950-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026950-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

84.2Max TPM

46.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	38.25	58.16
polyp at pH7 6	18	18	38.84	49.25
coral polyp · control treatment	16	16	51.07	66.49
coral polyp · oil and dispersant treatment	16	16	60.79	84.24
coral polyp · oil treatment	16	16	48.35	67.34
coral polyp · dispersant treatment	16	16	48.88	76.10
Polyp	10	10	38.28	54.03

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.16
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.20
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.17
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.12
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.84
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.96
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.42
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.96
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.50
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.16
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.36
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.25
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.91
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.90
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.17
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.81
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.51
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.16
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.13
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.84
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.08
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.30
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.49
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.82
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.81
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.97
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.59
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.44
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.57
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.99
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.06
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.13
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.74
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.84
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.29
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.24
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.72
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.38
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.21
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.68
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.36
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.14
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.96
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.65
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.20
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.24
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.41
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.37
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.81
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.07
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.86
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.70
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.57
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.15
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.12
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.84
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.95
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.93
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.06
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.67
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.45
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.07
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	54.03
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	45.13
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	44.59
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	40.87
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	39.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	36.50
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	35.67
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	34.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	30.43
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	21.12

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.