Gene detail

Detailed information of OS493_027327-T1 in Lophelia pertusa

Genomic Location: scaffold_148:291580...308925
NR annotation: KAJ7371213.1, hypothetical protein OS493_027327 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_027327-T1

ATGAGTCGAAGTCAGACGAGTACTAGTGTGAGAAGTACAACTTTTCACTCCGTGGGAATGTCGTCGGGATTAGCAATTCACGAACGAGAGAGAGAAGAGGAAAGACGACGAAGGGCAAAACTATCACGGCAGGCGTCTAACTCTAGTGAGCGCCCCTTATTTCCAGAACCCAAAAAGGTTCAGCCATCGGTAGGGGATATTCTTCAACAACAAATTCATGCCACTCTGGGTACATATGAGACCATTGAACCATCTCTTCTACAGCACAGCAATCATCTGTTCGGCATTCCAAGACTTCCTCAGACTCCTGTAGAGGGCGATCAGAAGTTCATATTTGACCCAAAGTCGAAATATTCCAAGAACTCGACTATTGAACTGAAGAAAGCCCAGGCATCTTTAAAAACTGTCAACAGAATCACGAAAGAAGAGTTGAAAAGCTCAAAGATTCCGAAAGTCAATGGAGTCTTGAATGGCAACGGACACCCAACTGCGAAATCTACTCTTGCGACCAAGTCACATGACACTATTGCTCTGACGAAAAACTCGACTCTATCACATTTGAAATCTCCCCCTGTCAATGAAAACTCTTCATCTAAATCAACTGAATCAAAGAAGACTCTATTACATTCAAAATCTCCATCTCTCAAGGAAACTACTCCATCTAAATCAACTGAATTAAGGAAGACTCTTACATCACATTTGACATCTTCAACTGTTAATGACAATGCTTCATCTAAATCAACTGACACAAGAAAGACTCTATCGCATTTGACATCTCCGACGCTCAAGGATACTACTCCATCCAAATCAACTGACACAAGAAAGACTCTATCACATTTGACATCTCCGACTCCCAAGGAAACTACTCCATCTAAATCAGTGGAAATGAAAAAGACTGACATCAAGCCAGTGGTTAATGGCGTGTTTAAATCTCGGCAAGGTGACAACAAGGACAAGGAAAAGGGGTCGGTTAAGGTCAAAGGGTCAAAGGAAGGCAAAGGCCATGGCGAGAGCGAGAATGGGGAAAGTTGTAAAGAAAAGAACAATAGATCAAACTCATCCAACAAGAGTAAACCACCTAAAATCAAGCTTTCCATGCCTGAAAGAAATCTTCCCGTGTCTTCAGTTGAGCTGGAAAATCTTGCTGTGCATGAACCAACCAACGTGGAAAAGATCATTGCGGAGATGCAGCAAGTTGCACCACCACTGACTGGAATCCACACGCCCATCAAGGGTGGTAACTCGATCTTTGCATTCCACCGAAATAGCATCCAGGACAACTCAATGCTGCCGGTCTTGCCAATAAAGAGGAAAGCTAGTGAAAATACAGAGGCTAAAAAAGACAGCGGCAACGGAGTGGTTCTGATGGACGACTTGATGCTTTCAGATGAGAGTGATGATGAACACGATCACCAAACTGCTTCACCAACCAAGACTAGCAAGACGGCTCGTCATCGCTCGCACTCGACATCTTCAAGTGGAAGTAGCAGTGACGACAGTGATTCAGATAGCAGTGATAGCGACAGTGATTCAAGTGGCTCTGACACAAATAACAACACTAAAGATAAACCAGTGAAATCTCCTGTGCATGTCCCTTCTTCTTCTCCAAAGCCTGCAAGTGGAAGAAAGTGGGGTTTAGATCAACTTTACAATGCTCTTAATCAGTCCTCCACATCGCCGACACAAAGACAAAGCCAAGCCCATCTGCGGCAAACACTGTGGGAGAAGATGGTGTCCGAGGAAATCAGTACTCATGAGAAGAAGAGCCCTGCACCTCCAGTTTCTGTTGATACTCTTGCGCCGTTTGCAGCGGATCTCCTTAGCAACAGCCCTGAAATAGATCATGGAGTTGACATTGAGTCGTTAACAGCTAAACTGGACGTTCCATGTGAAGCAGATGTGGCTCTGGACACTGCTAAACCTGTAAGTAGCGAGCTTGGACAGAATGGATCCTCTGTTAAAATTCAACTTCCAAAGGATAGCAACAAAGGTAAGAGGAGATTGTCCACTGCGGGATCCAAATTGAATTCTGGCCAAGAGAAAAGTCAGAGTGAAAACTCGCCAAAGAAACCTTTAAAGGCAAAGAAGGAGACAGACTTATGA

Transcript

OS493_027327-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004121 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05110 all species →	AF-4	AF-4 proto-oncoprotein N-terminal region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007797 all species →	Family	AF4/FMR2 family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10528 all species →	AF4/FMR2 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0010468 all species →	Biological Process	regulation of gene expression	Interproscan
GO:0032783 all species →	Cellular Component	super elongation complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_027327-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_027327-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

64.6Max TPM

24.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.99	28.08
polyp at pH7 6	18	18	16.26	28.40
coral polyp · control treatment	16	16	26.80	49.66
coral polyp · oil and dispersant treatment	16	16	33.12	51.97
coral polyp · oil treatment	16	16	25.55	46.83
coral polyp · dispersant treatment	16	16	43.52	64.59
Polyp	10	10	6.40	13.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.08
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.05
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.95
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.14
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.83
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.52
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.46
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.82
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.51
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.91
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.31
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.36
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.53
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.23
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.92
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.48
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.62
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.21
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.48
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.66
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.15
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.35
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.39
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.17
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.34
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.67
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.10
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.48
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.31
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.80
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.97
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.96
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.35
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.53
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.44
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.00
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.76
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.07
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.83
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.83
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.76
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.55
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.40
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.43
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.26
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.28
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.74
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.06
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.59
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.54
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.30
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.52
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.42
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.08
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.43
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.54
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.76
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.30
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.33
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.21
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.90
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.68
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.08
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.13
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.13
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.12

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.