Gene detail

Detailed information of OS493_027390-T1 in Lophelia pertusa

Genomic Location: scaffold_149:209619...267069
NR annotation: KAJ7355995.1, TNF receptor-associated factor 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_027390-T1

ATGGCGGAGGGCGGATTTCTCGGATACCTTGACCCATATGAAGAACTTGAAGATTTGGAAATACGTGCATTCCACCGACTAGAACTCGAAGATAAACCCATACAGTTTGGTGGGCATGATTTTGTGTTTGTAGATGGGTTGTCTGCAGGTCAAACGTGCTCCATTTGCCTTCTTGCCATGCGGAACCCCGTGCAGACTATATGTGGCCATCGCTTCTGCGAAAGCTGCTTGAAAGGGACATTCACGAGCCGTATATCAGAGCCCTTGACGGACCGCTATAATCTCTTCAGACCCAACAGGCGAGGCCGTGATCAAGTTTGTCCGCATGATAGGAATCCTATTCCTGAATATGGAGGGTTCTTTCGTGATGTAGCCTGGGAGAGGGATATACTTTCTCTACGCGTCAAATGTAAGAAGACTGAAAGAGGGTGTGACTGGACTGGGCAACTACGTCACTACGAGGAACACTTTACCTTATGCGAATATGAAGACGTGACTTGTGCTGCCTGTGAAGAAGTGTTGCAGAGACGGTTCCTGCAAACACACACAACTTCAGAATGTGACAAAAGGATCGTGCAATGTGAATACTGTGACAAGGAGTTCGAGTTCTGGTGCACAGAGATTCATAAAGGTGATCAATGCACACGTTTTCCTCTTGACTGTCCTCAAAAATGTGGAGTGCAGATACCCCGAGAGGAGATGGAGTCCCATGTGAAGGATGATTGTATGATGACGATGGTGGTCTGTCCTTACGAGCGAGCTGGTTGTACCTTCCATGACACAAAGAGTAATTTGACAACTCATCTTGAGGTCTCGACTGAGGAGCACCTGAACAAGACATGGTCTATGCTGTTAAAGACAAAAGAGCGATTATATGAGCTAGAGGCAATAGAAGATCAAAATGTGACATTGAAGAAAGACCTGGCAGAACTGCAAAAACAGTTTGAAGAAGTAAAACATACCGCTGCTAAAGGCCAGCAAGCGATCAGTTCACTGAATCATCTGCTGGGAGCTAAGAACGACCCTAGTGAGGGGTCGCCTGAGAAAAAGTTTGAACCACGAGTGCTCTTTACATCTCATCATTCATCTGTTCGTGGCAAAGAAAGACAACTTTGTGGTTGCGATTGCGAGGAAGATGATGCAGCATCGTCACGCATTTTCTTTGACAGAGATGAAGGAAACAGCAGTGGCAAACAGGACCGTCAAGATACTTTAATAGTGATGGAAATAACAACCGGTAGACGCCCCACAGCTGATCCCAAGCCTGAGTTAAAAGCTGGTGCTTCATACTTGTCAGAATATGTTGCATCAGAAAGTGAAAAGCAGCTATCTCCAAAGTCTACCGCAGAAGAAAAACCCAAGACTCCTCAACTTGTGTGGCATCAACCAAGAAGCAGAAGAGCTCAAGTTTCTTTGGAGCAACAGCCGTATGAGGGGACACACAGACTTTCAACTAGAACGGAGTCTCAAGGATCTTTAAGTTCTAGTCTTGACAGTCTTGAAGGCACAATATTCCTTAAAAGAGAAGGGACGGTGATTGATATGACTATTTATCGCCAAGAGGGAAGTCGAGGCGCCAAGAGAAACCCAAGAAGCGCAAAATTCCCTTCAATTTCTAGAAAGAGGAATTCTTTGAAATGTTTGCCGCCAATTTACGAGATCGACGAAGATTGCGAAGAAGTCGCCATTTTAGATGCTAAAGACAAACACAATCTTCAAGCTGGCAGATTAGGAAAAGTTTGTCGCGACTATGATGACAAATGTTACCAAGTAAATGCCATTGTGCCTTATGGAGAACATTGGGAGGTAAACCAAACGCGGAAACAACAGCAGAAATATCGTGAGTTTCCTGCACAAGACAGAAATGAGACTTGCGGTTATCATAAGCGACATCTTGGGCGCAATTCATCTGTTAACTCTCCGCACGCCGAGCGAAACAACCAGATGGTGTTTCCAGACTTTTTTCCTCCAGGGATGCACGTTCATTGCGCGCAAAACGCACTTCCAGAAGCAAGCAAAGGACTGTACATGAAAATTATGCAAGTCGAGGCTGAACTGAAGCACGCAACGAACATTTGCAAAACCAACAAGACAACGAGTAATAACTCCAGTTATAAACAGCAGAATTGGATGCAGTTTTTTGACTTTTACACGGATGAAATACTACACATTGACGAGGAGAAATCGGTGCCGCCATCAACAAAGAGAAAGTCACAAATAATGCCTTCATCTCACATAACCGAGGTTCTCGCTAATCAGGAATTGAGTCAAATGAGTGGGTACTTAAAGTACAAGAAGGGATGGCATGGATGGAAGAAATTGTGGTTCATGCTAAAAGACAATGTTTTGTACGGGTACAAAGCTAGCTCGGTGATGACTCATGAAACTCTGCCAGTACTTAGATGCCAAATCGAACGGTCGGGTAAGGAAGGAGATTACTGTTCATTCAAACTGAAACAAAAAGATATTCCATCCGTAGTTTTCAAGGCAGATGACGAAATTTCAGGAAGAAGGTGGATACAAGAACTTAAGAAAACACAACAGATCGAGTAG

Transcript

OS493_027390-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q28DL4	TNF receptor-associated factor 6 OS=Xenopus tropicalis OX=8364 GN=traf6 PE=2 SV=1
Q3ZCC3	TNF receptor-associated factor 6 OS=Bos taurus OX=9913 GN=TRAF6 PE=2 SV=1
Q6DJN2	TNF receptor-associated factor 6-B OS=Xenopus laevis OX=8355 GN=traf6-b PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0013253 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21363 all species →	TRAF3_RING	TNF receptor-associated factor 2/3/5, RING domain	Domain	Interproscan
PF02176 all species →	zf-TRAF	TRAF-type zinc finger	Family	Interproscan
PF00169 all species →	PH	PH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR049440 all species →	Domain	TNF receptor-associated factor 3/5, RING domain	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR001293 all species →	Domain	Zinc finger, TRAF-type	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10131 all species →	TNF RECEPTOR ASSOCIATED FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0033209 all species →	Biological Process	tumor necrosis factor-mediated signaling pathway	Interproscan
GO:0070534 all species →	Biological Process	protein K63-linked ubiquitination	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_027390-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_027390-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

13.6Max TPM

6.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.34	9.72
polyp at pH7 6	18	18	6.12	9.42
coral polyp · control treatment	16	16	7.81	11.34
coral polyp · oil and dispersant treatment	16	16	5.75	11.52
coral polyp · oil treatment	16	16	7.60	10.51
coral polyp · dispersant treatment	16	16	5.66	9.67
Polyp	10	10	6.06	13.60

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.72
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.46
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.37
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.27
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.63
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.17
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.16
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.01
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.96
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.35
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.08
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.49
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.05
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.97
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.59
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.54
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.17
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.84
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.21
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.11
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.34
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.04
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.20
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.98
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.61
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.12
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.73
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.52
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.43
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.04
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.33
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.39
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.42
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.22
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.51
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.32
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.79
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.48
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.41
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.47
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.85
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.40
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.35
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.60
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.91
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.32
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.46
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.86
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.75
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.54
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.39
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.60
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.62
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.35
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.65
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.39
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.65

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.