Gene detail

Detailed information of OS493_027572-T1 in Lophelia pertusa

Genomic Location: scaffold_151:386258...394542
NR annotation: KAJ7390047.1, hypothetical protein OS493_027572 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_027572-T1

ATGTCTGACGAGGCGGAGAAGAAGCCTACTGCACCCAGCGAAGACGGAGAAGCTAAACAACAAAATGCTACAAGTAATAAAGACGCTGAAAATGGACCGGGAAATGGAGACGCAACGAAAGAGCCCAAAAAATTTTCGGTCCTCAAAGTCAAATTCGGACCAGAATTAACCGATCCTATTGGAGACACTGATGACTCGAATGAACCTTCTTCATCCCCTGGAAGTACAACGGATAGACGGCCAACAAGCCCTCTGACTCCCGAGCACTTCACCTTTGGTTATGCCACGAACGAAGCTATCCCAATGACCATCTTTTATCGAAGCCAGCATTCGCAAGGTCACGGCGGCAGACAACGGCCAACTCTGCAGGAACTTCGTAAAGGATTAGAAAATGACAAGGCTGAATTTGCAGAGCAGCCGGCTCCTGTGGATGATAGTAAAGCAGAAGAGGGTGTGGATCCCGTGGAAGTAAGAAATAAAAGTGCGCCCAAGTTTGGCTGGATCAAAGGCGTTCTGTTTGGATGTCTCCTCAACATATGGGGTGTTATGCTGTACTTGCGGCTGTCGTGGGTAGTGGGTCATGCTGGCATAGGCTTGGCTTCTGTTATTGTACTTTTGTCCGCTGTGGTAACTACCTTGACGACGTTATCCATGTCTGCTGTTTGTACCAATGGTGAAGTCAAGGGAGGTGGGGCCTATTTTCTGATATCCCGCAGTCTTGGTCCAGAGTTTGGAGGCTCCATTGGTGTTATCTTCTCAATAGCCAGTGCCGTTGCCACGGCAATGTACGTGGTTGGTTTTTCAGAAACTGTACGGGATATCCTCAGGGAAAATGGCTCCCTCATGGTAGACGAGTCTAGTGACATACGTATTATAGGCCTTATCACTGTCATCATTCTGCTCGGCATTACTATGATTGGCTTACAGTGGGTGGTGCGAGCGCAAATGATGCTTCTTGTCGTGTTAGTTATTTCCATTGTTAGTGTCGTGATAGGAACTTTCATTGGACCGCAGTCAGAGGAAAGTGAAGCAAAAGGGTTTGTCGGCTACCAAAAGGATGTCTTCGAGACCAATTTTAGCCCTGGTTATAAGGATGAAAGTTTTTTCTCAGTCTTTGCTGTGTTCTTTCCTGCTGCGACAGGAATTCTAGCCGGGGTCAACATATCCGGTGATCTCAAAAGTGTGACCAAGGCTGTCCCGAAAGGAACATTGCTGGCCATTCTTATCAGCACACTTGTGTACATAATGCTTGCTTGGTTTGTGGGTTCATGTGTTGAGAGGGAAGCACTAGGGTTTGTGCAAGAGGTGTTGCAAAATGGAACCAATCAAACTCTGGCTTCTTGTGCAGAACAGACCTGTAAATATGGACTCCTAAATGACTTCCAGGTAATGGAGGCAGTGTCAGGGTGGGGTCCAATCGTAACAGCAGGAATTTTTGCATCCACCTTATCATCTGCCCTCGCAAGTCTTGTTGGAGCACCCAAAGCGTTCCAGGCAGTCTGCAAGGACCACCTCTTCCCATATATCTCGTTTTTCGGTGTTGGTTATGGACCTGGCAATGAACCCCGCAGGGGATATGTCTTGGCTTTCTTCGTGGCTGCGGCTTTCATCGCTATTGGAGATCTGAATGTCATCGCTCCCATCATTTCTAACTTCTTTCTCATTGTATACGCTCTCATCAACTATGCAGTGTTCGCGGCTTCTCTGTCACGTTCTCCTGGATGGCGTCCCTCGTTTAAGTACTATAATATGTGGGTGTCGCTGTTGGGGGCTGTGCTGTGCATAGCCATGATGTTCCTTATCAACTGGTGGGCGGCCCTGTTGACCATATTCATTGTGATGATATTGTACAAGTATGTGGACTTTACTAAGCCTCAGGTGAACTGGGGATCTTCTGCTCAGGCGTACACCTTCGTCCAAGCACTGCGGTACACTCGCCGGCTGGGTGGAATAAGTGATCACGTGAAAAATTTCCGCCCGCACTGCCTGGTGCTGACCGGTCGTCCCCAGGACCGCCCCAACCTGATGTACCTCGTGTCACAGATCACCAAAAATGTCAGCCTGATGGTTTACGCCAATGTTATCAGAAAACCATTTGGTACACTGCCCGCAGATGATGCGGACGCTAACTGGATCAGGGAACAGAAGATCAAAGCTTTCCGTGCCGTGACTACAGCCCCCAGTCTTCGCGAGGGTGTGCAGTCCATGTTTCATCTAGCTGGTCTGGGGAAGATGCGGCCAAACACAGTGGTCATGGGCTTCAAAAACAACTGGACAGATAAGAGGTGCTTAAATGAAGTGGTAGACTACCTCGGCGTCATCAATGACGTGTTCGAGCTTAACTACGGATTGATCATTCTTCGCATGAACGAGGAACAGAAGAAAGAATTCATCGTAGAGAAAGTTGAGGAAGAAAGTGATGGCGAAACGTCTTCTGGTTCCGACTCTATAATGGATGAAGATGAATATTCTAAGCCCAAACGTACCGCGGCGTCAAAAGGGGCGACAAAAGAGGAGAAAGAAAGCCTGACAAGCCCTGATCACGTGTCTGCGCCGGCCTCTGAAGATGGGGTGAAACCGCAGCTCCAACGATCGCACTGA

Transcript

OS493_027572-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P55013	Solute carrier family 12 member 2 OS=Squalus acanthias OX=7797 GN=SLC12A2 PE=1 SV=1
P55011	Solute carrier family 12 member 2 OS=Homo sapiens OX=9606 GN=SLC12A2 PE=1 SV=1
P55012	Solute carrier family 12 member 2 OS=Mus musculus OX=10090 GN=Slc12a2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001358 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08403 all species →	AA_permease_N	Amino acid permease N-terminal	Family	Interproscan
PF00324 all species →	AA_permease	Amino acid permease	Domain	Interproscan
PF03522 all species →	SLC12	Solute carrier family 12	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002443 all species →	Family	Solute carrier family 12 member 1/2	Interproscan
IPR013612 all species →	Domain	Amino acid permease, N-terminal	Interproscan
IPR004841 all species →	Domain	Amino acid permease/ SLC12A domain	Interproscan
IPR018491 all species →	Domain	SLC12A transporter, C-terminal	Interproscan
IPR004842 all species →	Family	SLC12A transporter family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11827 all species →	SOLUTE CARRIER FAMILY 12, CATION COTRANSPORTERS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0006884 all species →	Biological Process	cell volume homeostasis	Interproscan
GO:0008511 all species →	Molecular Function	sodium:potassium:chloride symporter activity	Interproscan
GO:0015377 all species →	Molecular Function	chloride:monoatomic cation symporter activity	Interproscan
GO:0015379 all species →	Molecular Function	potassium:chloride symporter activity	Interproscan
GO:0035725 all species →	Biological Process	sodium ion transmembrane transport	Interproscan
GO:0055064 all species →	Biological Process	chloride ion homeostasis	Interproscan
GO:0055075 all species →	Biological Process	potassium ion homeostasis	Interproscan
GO:0055078 all species →	Biological Process	sodium ion homeostasis	Interproscan
GO:1902476 all species →	Biological Process	chloride transmembrane transport	Interproscan
GO:1990573 all species →	Biological Process	potassium ion import across plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_027572-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_027572-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

14.5Max TPM

5.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.00	8.20
polyp at pH7 6	18	18	4.52	9.75
coral polyp · control treatment	16	16	7.36	14.48
coral polyp · oil and dispersant treatment	16	16	4.65	8.30
coral polyp · oil treatment	16	16	7.28	13.62
coral polyp · dispersant treatment	16	16	4.26	10.00
Polyp	10	10	2.50	6.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.20
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.04
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.40
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.97
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.84
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.57
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.10
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.02
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.65
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.72
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.27
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.30
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.17
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.21
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.35
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.52
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.32
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.32
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.48
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.80
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.85
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.97
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.29
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.32
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.26
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.51
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.64
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.51
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.34
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.66
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.62
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.85
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.26
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.99
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.18
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.48
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.33
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.09
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.79
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.63
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.82
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.43
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.49
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.23
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.12
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.31
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.56
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.97
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.72
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.