Gene detail

Detailed information of OS493_027602-T1 in Lophelia pertusa

Genomic Location: scaffold_151:812659...821056
NR annotation: KAJ7390077.1, Zinc finger protein gli2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_027602-T1

ATGCATGGAGTTGCACCTCCGATGTCTATTTCACGCGAGAGGAGACACACCGACTCTGAGATTGCCCGTCCCAAAGCTGAATGGCCGCCTGGGTACCAGCCCTTTGTCAAACCTAGCATACCATCAGATTACTTGGCAACTTTGCACAGAAATCCAGGATCTGACTACGGAGGGCCGCCATCCACCGCAACATCATTGAGATCAACGGTTATTGATCTTCCTCATTCAAACTTTCCAAGCCCAAGGCTGTCGGCAAGAATGAGTCGGAAGCGTGCACTTTCCAATACCCCATCATCTGTTGAATCCATTGACCTGAATGCACTGATAAGGGGCTCGCCAGATTCATTATCTGGGTACCTTGGGCCGAGAGTATCTTCAGCAGGGTCCTTTGGTCATTTGAGCCCCATTGGATTTTGTACCTCTCCTGGTTCGCGCCAGCAGGCAGCAGCTCGCTATCCCATTGCTAGAAATGTATTCATCACACCTCCGCCCATCGCCCCTCCCCGATTACCAACACCATCTTCCACGAGAGACACGGTGCCAAGTTCGACAACTGGCGCAGACGGGACAAAGGAGGAAGCACACGAGAGCATGAGTTGTGCTGAGTCACCTCAAGTGTCAAACATTAAAGAACCAGAAGGTGTCAGCTGTAAGGAGGAAAGTATGGACATCTGCCCTCTTGACTCCACAACGTCACCTGGTGCTTCGGAAGTGAAGCAGGAAGGTTCAGATAATGAAGGAGAGGAGAATCAAGCTGAACAGGAAGTGCGCGATTTGACTTGTTATTGGAAAGAATGTCAAACGCAGTGTGAATCACAAGACGATCTCGTCAAACATGTCAACAGTGATCACATCAAAAAGGATCGCAAGGACTTCACATGTTACTGGGATGGTTGCACCAGAGAAAAGAAACCCTTTAAAGCGCAGTACATGTTGGTTGTACACATGCGACGTCACACTGGGGAGAAGCCACATAAATGCACATATGATGGCTGCACCAAGGCTTACTCCAGACTTGAGAACCTCAAGACCCATCTCCGATCACATACAGGAGAGCGGCCATACGTGTGCGAGGTGGAAGGATGCAATAAGGCATTCTCTAATGCATCGGACAGAGCCAAACACCAAAATAGGACACATTCCTCAGTGAAACCCTATGTCTGTAAAGTTCCTGGCTGCCCAAAACGGTACACGGATCCTAGCTCGCTCAGAAAACACACCAAAACAGTTCATGGAGAACAGGGAATCAAGAGGCTGAAAGCTGAAGGCAGCAGAGAAAAACCACCATCAAATCCGGATAAAAAGGGGAGTGTATCCCATGAGAAAAGCCAAGGAACTCAAATGTCCAACAATACTGCACAAGCTGCAACAAAGCCAGTGAGCAATCAAGTTGATGAACCTATGTCACCAGGTAGAGAAGGATCAAGCAGTACTGACCCTGCTGACAGTGTAATTCAAGGTGGAAGTTGCTCTCAAACATTTATAGGCAGCAGTTTCGAGGGGGATGCAGTTTCTTCAAGCTGCGACAGGACCCCTGGGGGACTTGATATCCCATCCAGCCAAGATAGCCCAAGAAGTTTGGGCCAGTCCACATTGGGCATATCTCCGAGAAGTCCTCCATTTGTAAGCCATCTTCCAGATATTTTGGAAGGAGATTGGGAGCCTGCAGAAAGTGGTGCTGTGACAACAGCACAATCCATCGAGGCCAGACCTCAAGCCCAGAGTGTCAATTTTCCAAAGATCGATGTTCACAAAAGGGATGTAGCACTTTGGGTGAATGATGTTCACCGGCGAATGAGCCAATCATCTCGCAGATCAAGTGAAGGCAGCCATTTATCTGTGGACCTTGCTGGCGATGCAAGTAGAAGATCCAGCCAGGAAAGTGGTTGGTCTTCTTACGGAAGTCGCCGATCCAGCCAGGCTAGCCCCTTTCCTACTACAAATATTCAACCTCAAGAGGTTATTCCCCATTTTCCCAATGGCTGTAGTGTTCCCCCAGTACAAATAGGAATGACTCCTCTTCCTCATCGCAGACCACATTTACATCCACTTGATGGCAATGAAGATGCCCTTCGCCGGACCAGTGAGACAAGCACCTGCAGTAACCAAAGTGCACCGTACAACAGATTGAGCCGTAATAGCAGTGGTTATGGAAGTCAGTCAAACTTAGCAGTTATTCGAAGTCCCATGTTCCACAAGATCCCACCTTCATCTCATTTACTACCTCAAGGAATTACATGCACTGATGCCGCAAGCAGAAGGAAAAGTGACACAGTGATTTGCGAGGCAGACAGTTCTGGAAGCTACCTTGCAAAAAATGGCAAGGGTGAGCAGCGCCGTAGCAGCGAACCCATCAGACAAGCAAGAGTTCCCATGGCTAGGGTGGAACCACCAAGTGGACCGGTTAACAGGCAAGCAACGCCGATGCCGAATGTGAATGAAACAGAACTGATTTGTGGTGATTTAGATCCACAAGAGTTTGATGCCTACCTTAATCCACAAGAAGAGGGGCACTTGGAACCTACTCCTCCTTTAAACCCTCCTCCAGGAAATCAAGGCATGTCGGTTCCACTACCCAGGCAGACACAACGCTTATGCCACTACCCATATCCTGAAGAACAACAGATGTCAGCTCAACCACCACAGCAACAACCTTGTTTACAGACTGTGCATCACCGACCCCAGTCATTCTTCCCATCACAGCCCAACCCTTCAAGTCATGATCACGAGCCACATCAAGTAGTTATAGGCCAACAAAACCCGCCAGAGCCACAAGTTGTGAGAAATCCTCCTCAAGAAGGGCACTGGCCCCCACCTAGGTACAGCACTGGGCAGCAGCTGATCACACCAGAAGTGCATAGTGGCTTCTACCCACCATCAGAAACTGTTGCTTATGGCACTACAATGCAGACCTCTGGCCAGAAGAGCCAGTATGACATGGGAAACTATGAGGATGCAATGGTGTCGGGAATCGGTTCACTATCAACTGACAATGGTGGTGTGTCTGAGTTTGTTGGGAATGGAAACATGGTTGTTAATGACATGAACACTCTGTTGAACTCTCTTCGTGAGGAAGAAAGATACCTGGAGATGTGTCAAAACTCAAGAGGTCAAATGGCTGGTAGTGCTATGTCCATCTTTTAA

Transcript

OS493_027602-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5IS56	Transcriptional activator GLI3 OS=Pan troglodytes OX=9598 GN=GLI3 PE=2 SV=1
Q9IA31	Transcriptional activator GLI3 (Fragment) OS=Gallus gallus OX=9031 GN=GLI3 PE=1 SV=1
Q61602	Transcriptional activator GLI3 OS=Mus musculus OX=10090 GN=Gli3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007643 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00096 all species →	zf-C2H2	Zinc finger, C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan
IPR043359 all species →	Family	C2H2-type zinc-finger protein GLI-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45718 all species →	TRANSCRIPTIONAL ACTIVATOR CUBITUS INTERRUPTUS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000977 all species →	Molecular Function	RNA polymerase II transcription regulatory region sequence-specific DNA binding	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_027602-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_027602-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

28.5Max TPM

12.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.41	24.28
polyp at pH7 6	18	18	13.66	22.91
coral polyp · control treatment	16	16	17.11	27.78
coral polyp · oil and dispersant treatment	16	16	13.66	25.44
coral polyp · oil treatment	16	16	12.26	27.54
coral polyp · dispersant treatment	16	16	13.68	28.50
Polyp	10	9	2.33	3.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.42
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.67
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.26
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.56
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.21
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.50
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.74
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.68
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.05
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.31
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.91
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.32
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.16
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.83
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.58
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.29
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.07
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.81
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.78
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.39
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.26
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.05
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.40
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.63
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.89
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.63
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.49
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.78
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.34
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.07
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.85
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.17
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.41
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.44
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.76
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.73
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.30
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.08
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.76
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.12
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.80
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.54
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.32
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.07
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.68
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.08
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.89
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.73
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.89
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.21
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.50
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.09
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.41
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.43
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.10
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.07
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.29
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.71
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.45
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.32
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.94
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.54
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.78
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.91
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.99
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.42
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.87
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.66
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.