Gene detail

Detailed information of OS493_027752-T1 in Lophelia pertusa

Genomic Location: scaffold_153:583980...599356
NR annotation: KAJ7377673.1, Mitochondrial 10-formyltetrahydrofolate dehydrogenase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_027752-T1

ATGCTCTCTGCATTTCGTTTTGTACAGGTAGCAGCGAGAAGAACTATCTACACTTCGACAAACGCAATGGGTTCCTTGAAAGTCGCCGTGATCGGCCAGTCGCAGTTTGGTTTGGAGGTTTACAAAAGTCTTCGCTTGAAAGGTCATGAGATTGTCGGTGTTTTCACTGTTCCTGATATCAAAGGAAAGCCAGATATTCTTGCGGCGGGAGCTGAGCAAGACGGAGTGAAAGTTTTTAAATTTCCGCGATGGAGGACCAAAGGGGAACCGATCGCCGAAGTGGTCGACACGTACAAAGCTTGCGGGGCTGAGTTGAACGTTATGCCATTTTGCTCGCAGTTCATTCCCATGAACGTGATTGATTTCCCTGAACATGGCTCGATTATTTACCATCCTTCCTTGCTGCCGAGGCACAGAGGAGCTTCGGCTATAAATTGGACTTTAATGGAAGGAGACAAACAGGGAGGCTTCAGCGTGTTCTGGGCTGACGATGGTCTGGATACAGGTCCAATCCTTCTTCAAAAGAGCGTGGATATCGAACCTAATGAGACAGTGGACACTCTGTACAATCGCTTCTTGTATCCTGAAGGCATCAAAGGCATGGTTGAAGCTGTTGATCTGATTGGTGACGGAAAGGCTCCAAGAATTCCTCAACCAGAAGAAGGAGCAACTTACGATAAAATCTGGAAAAAGAAAGAAGTCGCAAAGATAAATTTTGCTCAATCAGCTGAGGCGCTGCACAACTTCATTCGTGGAAATGACAAACTTCCAGGAGCGTGGGCTATGATTGATGGTCAGCAAGTGACATTTTATGGTTCATCCCTGACACCTGGTGACAAAGCTCCTGACGGTACCGCTGTAACAATTGAAGGCTTGGATACACCTGCTATTGTCCACAAGGGTGGCATGACACTGACAGGGACTGACGGCAAGATGATGTCTGTCAAGACTCTACAGCTTGAGGATGGATGCATGATCCAGGCAGCCAAGTATGGCCAGGCAGAGGAGGCAGCAGAAGCTATTGAACTCACTGACGAGGAGAGGGTCATGGAAGCTAAGCTGAGGGAAATATGGGCTGGAATTTTGGCAAATCCAGATGTTCTTGAAGACACTGACTTCTTCAAAGCTGGAGCTGGGTCTATGGATGTTACCAGGCTTGTTGAGGAGGTGAAAGAGAAGTGTGCAGTGGTGCTAGAGGCAGAGGAAATTTACATGAATACAAGATATGGAGATTTTGTTCGTTTGTCTGTCCTGAGATCACGTGGAGGAGGCAAAGAGGAGTTCAGCTGTAACACTTTTGACCTGGATGTGAACCACATGACGGTCCATATACCTCATCAGCTGTTTATTAATGGAGAGTTTGTGGACTCCTCCAATGGACGCACATATGACGCTATCAACCCAAATGATGGCTCGGCTATTACCAAAGTCTCTTTTGCCAGCGTCGATGATGTGGATACAGCTGTTGCTGCAGCAAAGGAAGCATTCTACAATGGGCCTTGGGGAACGATGAATGCCAGAGATCGTGGACACCTGATGTACAAGTTGGCTAATCTGATGGAGGAACACCAAGAGGAACTGGCCACATTAGAAGCTATTGACTCTGGTGCTGTGTACACTCTTGCTCTGAAGACCCACATTGGCATGTCTATTGCTACACTGCGTTACTTTGCTGGATGGAGTGACAAGATTCAGGGACTGACAGTTCCGATCAATAACGCCAAACCCAACAGAAACTTGTGCTATACTAAACGAGTACCAATTGGTGTGTGCGGTCTGATTGTGCCTTGGAACTATCCACTCATGATGTTAGCATGGAAGATCTCTCCTCTGTTAGCTGCTGGTAACACAGTTGTACTCAAACCAGCTCAGGTGACTCCATTGACAGCTCTCAAGTTTGCTGAGCTTTCTGCCAAAGCCGGATTTCCAAAGGGCGTTATCAACATTTTGCCTGGATCAGGGTCTATTGTTGGTAATCGTATCTGTGCTCATCCTGATATCAGAAAGGTCGGCTTTACTGGATCAACTCAAACTGGCAGATCAATCATGGAAAGTTGTGCTGTCAATGTCAAGAAGTGTTCTCTGGAGTTGGGTGGCAAATCACCGCTCATTATCTTCTCTGATTGCGACATGGACAGAGCTGTGAGACAGGGAATGATGGCCTGTATGTTCAACAAAGGAGAAAACTGCATAGCTGCTGGTCGGCTTTTTGTTGAAGCATCAATTCATGACGAGTATGTACACAGAGTGGTTGAAGAGATCAAAAAGATGAAAATTGGTGATCCTCTTGATCGTTCAACAGATCATGGCCCTCAGAATCACAAAGCTCATCTTGATTCTCTTGTCGATTTCTGCAAGAAAGGCGTGGAGGAAGGAGCAACGTTAGTTTGTGGTGGCAAACAGATTGACAGGCCAGGGTTCTTTTTCGAGCCTACTGTATTCACAGATGTAAAGGACAACACTTTTTTGTCTCATGAGGAATCGTTTGGTCCAGTTATGATTGTCTCCAAATTTGAGGATGGTGACGTTGAAGGTGTTTTGAAGAGTGCCAATGATACAGAGTATGGACTTGCCTCTGGTGTTTTTACAAAGGATTTGAGCAAGGCTCTTCGTGTGGCTGACGCACTGGATGCAGGCACTTGCTTTGTCAACACATACAACAAGACTGATGTTGCCGCTCCTTTTGGAGGGTTTAAGCAGTCTGGCTTTGGAAAAGATTTGGGGGAAGAGGCACTGAATGAATACCTGAAGACTAAAGTTATCACTGTTGAATACTGA

Transcript

OS493_027752-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6GNL7	Cytosolic 10-formyltetrahydrofolate dehydrogenase OS=Xenopus laevis OX=8355 GN=aldh1l1 PE=2 SV=1
Q63ZT8	Cytosolic 10-formyltetrahydrofolate dehydrogenase OS=Xenopus tropicalis OX=8364 GN=aldh1l1 PE=2 SV=1
Q3SY69	Mitochondrial 10-formyltetrahydrofolate dehydrogenase OS=Homo sapiens OX=9606 GN=ALDH1L2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004225 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02911 all species →	Formyl_trans_C	Formyl transferase, C-terminal domain	Domain	Interproscan
PF00551 all species →	Formyl_trans_N	Formyl transferase	Domain	Interproscan
PF00171 all species →	Aldedh	Aldehyde dehydrogenase family	Family	Interproscan
PF00550 all species →	PP-binding	Phosphopantetheine attachment site	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011407 all species →	Family	10-formyltetrahydrofolate dehydrogenase	Interproscan
IPR016161 all species →	Homologous_superfamily	Aldehyde/histidinol dehydrogenase	Interproscan
IPR009081 all species →	Domain	Phosphopantetheine binding ACP domain	Interproscan
IPR005793 all species →	Domain	Formyl transferase, C-terminal	Interproscan
IPR016163 all species →	Homologous_superfamily	Aldehyde dehydrogenase, C-terminal	Interproscan
IPR036477 all species →	Homologous_superfamily	Formyl transferase, N-terminal domain superfamily	Interproscan
IPR036736 all species →	Homologous_superfamily	ACP-like superfamily	Interproscan
IPR037022 all species →	Homologous_superfamily	Formyl transferase, C-terminal domain superfamily	Interproscan
IPR029510 all species →	Conserved_site	Aldehyde dehydrogenase, glutamic acid active site	Interproscan
IPR016162 all species →	Homologous_superfamily	Aldehyde dehydrogenase, N-terminal	Interproscan
IPR002376 all species →	Domain	Formyl transferase, N-terminal	Interproscan
IPR015590 all species →	Domain	Aldehyde dehydrogenase domain	Interproscan
IPR011034 all species →	Homologous_superfamily	Formyl transferase-like, C-terminal domain superfamily	Interproscan
IPR001555 all species →	Active_site	Phosphoribosylglycinamide formyltransferase, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11699 all species →	ALDEHYDE DEHYDROGENASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006730 all species →	Biological Process	one-carbon metabolic process	Interproscan
GO:0009258 all species →	Biological Process	10-formyltetrahydrofolate catabolic process	Interproscan
GO:0016155 all species →	Molecular Function	formyltetrahydrofolate dehydrogenase activity	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0009058 all species →	Biological Process	biosynthetic process	Interproscan
GO:0016620 all species →	Molecular Function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	Interproscan
GO:0004029 all species →	Molecular Function	aldehyde dehydrogenase (NAD+) activity	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00289	ALDH1L; formyltetrahydrofolate dehydrogenase	EC:1.5.1.6	One carbon pool by folate	ko00670	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_027752-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

431.9Max TPM

89.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	47.05	103.45
polyp at pH7 6	18	18	56.88	118.76
coral polyp · control treatment	16	16	113.16	431.93
coral polyp · oil and dispersant treatment	16	16	149.40	336.25
coral polyp · oil treatment	16	16	73.69	142.54
coral polyp · dispersant treatment	16	16	147.12	272.58
Polyp	10	10	21.67	42.71

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	101.71
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	69.97
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.51
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.32
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.94
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.70
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.09
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.07
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.02
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.32
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.97
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.46
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	118.76
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	116.91
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	99.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	96.58
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	75.63
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.89
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.77
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.70
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.06
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.68
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	431.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	178.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	125.16
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	117.68
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	115.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	106.25
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	96.35
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.04
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	92.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	87.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.60
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.15
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.43
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.34
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.22
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	336.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	232.34
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	197.34
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	192.20
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	175.29
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	168.41
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	138.92
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	138.16
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	136.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	130.30
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	113.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	104.86
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	99.85
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.39
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.16
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.75
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	142.54
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	129.08
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	117.83
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	109.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	106.75
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	90.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.29
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.34
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.40
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.94
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.07
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.86
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.39
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	272.58
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	240.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	236.71
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	229.87
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	192.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	188.47
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	180.30
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	176.28
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	154.19
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	144.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	90.93
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.92
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.51
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	42.71
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	30.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	25.93
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	25.91
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	23.36
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	15.27
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.89
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.14
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.03

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.