Gene detail

Detailed information of OS493_028190-T1 in Lophelia pertusa

Genomic Location: scaffold_160:323172...330097
NR annotation: KAJ7371028.1, Zinc finger FYVE domain-containing protein 26 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028190-T1

ATGCTTTCTTACATGGACCCCAGCCCTGAAATGCTTAGCCTGTCTAAGTGTCTTGATGATCTGTTCAAGAATCTTATAAACCAAACGCTCAATCACCAACACAGCTGTCTCGACAAGGGTACTTTGTATTCCTGCCTTCTCAGCCAATCGACAACTTATTTGATCGAAAAGTTCTGTTACATGGAAAACCAAATGCGGTTTTTAATAGAGGGCCATCCTGAATTACCGCTGTCAAGGTCAACTCTGCAAGGATTTAAACGACAAGCTGCTGCATTAGTTGGTCCCTTTGTTCAAGTTTGTTATACCCAGTCCTTCATGGAGGATAGAAAAGAAGCTTGGGAATTTCTGTTTTTTCATGCATTGAATGGAAATCATATCTTGGAAAATATAGTGGAAACAGCTCTTGTGTTTGTTAAGGATGGCGACTTCTCTAGGCTGATGCAGCTTCTGTCTCCTGTGGAATTTTCCAGGCTCAAGCCACTCGTGCTACTCCTGGGTTGGCCCTACTGCTACAGCTGTGAAAATGCCAAGAATCTGCTGGAAGCTCTCTGGAATCCTACGGAGAAGGCTGCCCACCCATCACTGTACCAGGCCTGTCAGAAACTGGCTTATCAAGTTCAACTGGTTCAGTGGTGCACAGAGAAGGCTCGTCCTTTACTGGCATCAACAGATTCAGGCTCAACCCAGCATCAGCAAGCATCAGAGATGTTCCAAGGTCTGGAGTCGCACTCTGTTCTACATGTGCTTCACAAGTCAGTTAGTCTAGCTCATCTCCCAGAAAAAGAAGTCTTCGAACTTTTGAGGAAGAGACCTGTGTTTAGTCCTCTAGATGCCAGCATAACCACTGGGCGCCCAGGAGAAGTCATTGAAGACAGATTAGACAGAGCACAGAAAGCTGAAAGTGAAGATGTTGCAGAACGAAATCTGGAGAATGGTCCAGACTCGGAAATTCATCCTGAAGTTCAAAGAGATATTTTTTTGTACCATAGTTACTGTGCGCTTAGGGATTTCATGGAAGCCGTTACATCTTCTGTAGAGGAGAACTCTGCTAAAGATAATTTAGAAGCACTGCATGAATCTGCTGAAGACCAAAGTGCTGAAACTTTGAGCTCGGTGACAAGTGAACATTTTGATTCAAGTCCAGACATGGCTTGTCAGAAACAAACGTACTGTGCACATGTTGCGAGTAAGCTAAACGCTGGAAAGCATCATTTGGCGCAAGTTTATCCGTTGACATACAGGGTTGAAGTTCTTGAGAATATCTTTAGCCTTTTGTTTGGCACTTATGAGGATCTTTATGAAGGGAGTCTAGCACAGCACAACGAAAGCGATGATTTAGAGACGATGGACGAAGAAACCAGGAGTCTGTCGAAAAGCAGTTGGACTGGAAGCTGGGAGAGCCTTGCTAGCTCCGTTGACTTGTCTTTTGATGGGCACGCTCCTAACACTCCTTTAAAAGACCAAGAAAAAACATCAAGTCCAACAGCATCACTGCCGACGACACCTGACAGCACACAAAGGCTAAAAGAAGCAGTCATGCCACCAGCATTGGACTCTGCATCACGCAGACAGCTGTTTAGAAATGGCGGCAGGTCTGAATCAGATTTAGGTTTGTTGAAAAAGGTGTTGTTAGATGGAGATGAAAGATTAGTGCCTGCCACGTCACAAGATGCACGCGTGACTGCTACGTCACAAGCTGTTACGTCACAAGATGCAAGAGCGCCTACTACGTCACAAGATGCGAGCAGTACCGTCACCCTCAACGCAAGGCAATCAGAGAATGAATCGTTAAGCGGTAATTTGCACTCCAGTAAAGGTTCCTCAAGAGCTGCGGTATCTGATGAGAACGATTTAAAATGTGAATTTGTGATTGATGATGAGATTGTGTCAGATGTGTTGAAGACGTTAAAGGAATGTCTGATGGAGCTCAACACAGCAAAGTTCACTGAACTCAAGAAAGAAAAGTCAGAATCGGGCGTAAAACAACCGTTGCAGGACTTTCTTCAAACGTCAGTGCTTCGCAACACCATGGAGCAGCGTATTTCTCGTCTGGGCCAGTTCATTAATGAAGCTCAGTGGCGCTACCAGCTGGTGTCCTGGAATGATGGCACCAACAGTCAAAAGACCAGGAATTCCAGGAAAAGATTGACCAGAAAATCTATCAGTTAG

Transcript

OS493_028190-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003079 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_028190-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR028730 all species →	Family	Zinc finger FYVE domain-containing protein 26	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46591 all species →	ZINC FINGER FYVE DOMAIN-CONTAINING PROTEIN 26	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000281 all species →	Biological Process	mitotic cytokinesis	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0005765 all species →	Cellular Component	lysosomal membrane	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0030496 all species →	Cellular Component	midbody	Interproscan
GO:0032266 all species →	Molecular Function	phosphatidylinositol-3-phosphate binding	Interproscan
GO:0032465 all species →	Biological Process	regulation of cytokinesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_028190-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028190-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

13.4Max TPM

2.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.42	5.28
polyp at pH7 6	18	16	2.36	4.31
coral polyp · control treatment	16	16	3.61	6.86
coral polyp · oil and dispersant treatment	16	16	3.15	13.41
coral polyp · oil treatment	16	16	2.52	4.99
coral polyp · dispersant treatment	16	15	2.92	6.85
Polyp	10	8	0.65	1.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.34
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.29
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.18
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.07
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.94
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.49
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.59
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.34
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.87
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.82
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.60
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.23
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.18
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.63
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.82
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.36
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.96
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.57
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.73
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.41
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.62
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.95
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.11
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.71
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.44
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.81
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.68
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.99
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.84
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.41
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.11
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.91
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.66
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.90
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.88
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.74
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.11
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.86
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.08
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.08
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.08
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.98
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.58
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.44
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.80
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.99
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.67
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.09
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.