Gene detail

Detailed information of OS493_028194-T1 in Lophelia pertusa

Genomic Location: scaffold_160:349122...365464
NR annotation: KAJ7371032.1, Vacuolar protein sorting-associated protein 54 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028194-T1

ATGCTACGATTAGTGGATCCAAATGAGGCAAAACCATGGCAGAGCTGTGCAATTTGTAGCGACAAGATATTTTTCAGAACTCCAAGAGAGTTCAGCTCTCATTTGAGACAAGCGCATTGTACGAAAGAGGGAGGGTCGTTTGTTTGTCGTTATGGCAAAAATGGCGTTTGCCCTTCTTTACCTGTTGAAGGTGTCAGCGACAAAGATTACGAGGCTCATGTGAAGAAAAATCACACTAAACACGAAGAGATAAAAGCAGAGTTTAACGCCACTGTTACTACTGATGAAACGCTGTACCCAAGACCACGATTACCGCCCATCTCATTTCCTAATGCAAATGCATTCACAGTCTACTCTTCTACGCAAAACCTTCCTGCCATCCTAAATGACCCAAGATTACTCAAACGACAGACAGACTTCTTCACCAAGGCATGGGGTGAGGACTTCGTGCCACAAGAGGTTCCGCCACTCACACTGCTTCCTAGAATTCCAACAATCTACTTTGACGACTACCTCAAGAAAACAGAGTTTAGAATTAAAGTTCATCACAAACTTAAGAGGCAGTTGATTGTCGCAAGCACGACAGCCACTCCTGGTGACACTGGTTTTACTGCAGCTGCAATTGCCGCTGCCAAAAGACAGAGTGTTGACAAAGTTGCTTCAGATATCAGCTTGATACCAAAGGTGTTTATGATGCCCAACTTTGCCCTGGAAGATCCTGAGATATTTAACCATGTTCTTCCTTGGAGTATGGTTACACAGGAAACAACAACTGAGGGAGTAAAAGGCATGCAGAGGAACTCAGCAAAGCTTCTTCAGGAAAAGCTATCACATTACCTGGACATCACAGAAGTGAACTTGGCTCATCAGATCTCGCTACGATCAGAGGACTTCTTCAGTGCAATGGCATCCCAAGATCAGCTGCAGGATCATGTTGGAGAGACAGTCAGTGAGATCAAACACTTGAGAATGAAAGTACAGAAGGTACAAGAGGTTTTGTGCTCAGGATTCCTGGATGTTCTCAGGCTTTCATCTTTACGGTCACGATACCTCAGTGTATATGAAAAGTTGAAACTGATGGCCACAGTTCATCAAACACAGCCCACAATTCAGCTGTTATTATCAACGTCTGACTTTGTTGGTGCACTGGATCTGATCAGCACCACACAGGAAGTTTTACAACAAGAACTGGCTGGCATTCAGAGCTTCAGACACTTAGGCTCACAGCTAGCAGAACTTGAACGAGTCATTGAGCGAATGATGGAAGCAGATTTTGTGGAGTTTGCTACAGCTAATCTTGGCAGGATGGCTGAAGATGAGATGGGAAATGAAGACCTAGTTGATGAGGATAGGCTTGTGTCAGTGTTGTTTGGTCTCCTTCGGAAGCACAAGTTTCACTTCTTACACTTGTATCGTGATGAGGCTTATTCTACAATAAAGAGCACAATCAGACAGACGGTGCAAGATATTGTTACAGACAGTAGTGAGAATGAAGAAGAAAGTCAAAGTCTAGCTGATGCTCTGAGAAGTTTGGATTTCCTACAGTGGATGGGCATGCTAGAGAAAGTGTTCAGCGCATCGCTGAATGTACTGAGAAGGATGCAGGTGATGCACCAGAGCATTGTGCGTGTATTGGTGATAGCAGTAGGCGGTGTTAAGTCTCACTCCGATCCTGATGATCTGGACAGCATAGACATACCTGAATCTGATTCTGATTTCCTTAAACCAGTCTGCAGTGGAATGGACATTTTGATAACCACAACTGATTATCGTAAACTGACGCAGGAGAGTAAAGAGCTTCTTTGTGCAGCTTGTGAAATGGCACAGCTACGGTGTGCCAAACTTATCAATGTCAGAGGAAAGGCTGGTTACCTGGACAGCTTATCGTCATCAGAGTTTGTCCGGCTGACACGTATGGTTGAAGACTTTGTTATGGACTGCGAGAGGATTTGTGGAAGACAAAGCCACAGCCTAAGAGCCACTCTCTTGTCACAAGCTAAGAAATTTGTGGAAAGGTTCCATGAAGAACGCAAAAATAAATTAAGTTTGATATTAGATAATGAAAGATGGAAGCAGGCTGATGTTCCCACAGAGCTGCAGTCCTTAGTAGATTCTTTAGTTGATGGTGTTTACCCACGGGGAAAGGAGTCCAAATTTTCCATAGGTCCCACAGTCACTAGTGAACAGAAGCCATCGCCAGATTTACTTGTAAATGGACAAAGATTTTCTGTTGTTGGGACAGTACTGTTATTAGTGAATATGTTAGTGGAATACTGTCAGTGTGTGGATGATACTCCTATGCTCGTCACAGACATCATGAATAAACTATTTGAGACTCTTAAGATGTTCAACTCAAGGACTTGTCAGTTGGTTCTTGGAGCAGGCGCTCTTCAGCTTGTTGGACTAAAGACAATCACTGCAAAACATCTAGCTCTTGCCGCCCGATGTTTAGAAGTGGTTACAATTCACATTCCTGTTTTCAAAGCACATTTCGAGCAAAGGCTCCCTCCTAAACAATACGTACTGTTGTCGCAGTTTGATCAGATACTCAAGGATTACAACAATCACCGCCAGGAACTGTTTAGTAAAATCGTGAACCTCATGGAAGAGCTATTCAAAAATATTTTCTCAAAGTGGGAAGTGAAAGCTCCAATGCCGTCCCAAGCCATGCGCAGTGCTGTCAAGCAAATCACAAAACTTCACGAGTCCTTGTCACTTGTTTTACCTGAAACTCAAGTCGAGTCCATATTCCGGGACATCAAAAGAGCTTTCAAGCAAAGTCTGGCGCACAAATTGGACAAGTTAGGAATGACGAATGATGGCGGTCCGCAACACGGACTTGTGACATCAGATCTAGCGTTCTTCAAGGAAAGCCTGAAGAATCTCAGTGGACTGGGGGACATTGGCAGAAGCCTGGATGACCTGTGGAGAACAGTGAACGAGCTCAAAATCAACAGAGGGTCACCATCCACGGGACGGAAAAATATCCTGCAAAGATAG

Transcript

OS493_028194-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9P1Q0	Vacuolar protein sorting-associated protein 54 OS=Homo sapiens OX=9606 GN=VPS54 PE=1 SV=2
Q5SPW0	Vacuolar protein sorting-associated protein 54 OS=Mus musculus OX=10090 GN=Vps54 PE=1 SV=1
Q9JMK8	Vacuolar protein sorting-associated protein 54 OS=Rattus norvegicus OX=10116 GN=Vps54 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004663 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07928 all species →	Vps54	Vps54-like protein	Family	Interproscan
PF10475 all species →	Vps54_N	Vacuolar-sorting protein 54, of GARP complex	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039745 all species →	Family	Vacuolar protein sorting-associated protein 54	Interproscan
IPR012501 all species →	Domain	Vacuolar protein sorting-associated protein 54, C-terminal	Interproscan
IPR019515 all species →	Domain	Vacuolar protein sorting-associated protein 54, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12965 all species →	VACUOLAR PROTEIN SORTING 54	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000938 all species →	Cellular Component	GARP complex	Interproscan
GO:0006896 all species →	Biological Process	Golgi to vacuole transport	Interproscan
GO:0019905 all species →	Molecular Function	syntaxin binding	Interproscan
GO:0042147 all species →	Biological Process	retrograde transport, endosome to Golgi	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17600	VPS54; vacuolar protein sorting-associated protein 54	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028194-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

49.2Max TPM

18.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.52	21.41
polyp at pH7 6	18	18	17.05	25.55
coral polyp · control treatment	16	16	22.42	42.75
coral polyp · oil and dispersant treatment	16	16	23.94	49.18
coral polyp · oil treatment	16	16	19.31	26.32
coral polyp · dispersant treatment	16	16	12.43	18.11
Polyp	10	10	15.86	20.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.17
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.22
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.75
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.26
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.70
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.32
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.96
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.87
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.48
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.77
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.14
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.01
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.72
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.55
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.40
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.01
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.20
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.62
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.54
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.84
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.03
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.43
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.53
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.98
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.73
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.31
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.42
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.35
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.50
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.27
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.82
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.19
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.44
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.65
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.96
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.66
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.18
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.39
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.58
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.13
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.98
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.42
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.21
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.33
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.58
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.08
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.03
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.96
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.32
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.82
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.24
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.97
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.71
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.05
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.86
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.91
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.88
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.95
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.74
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.30
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.85
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.18
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.00
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.81
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.40
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.91
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	20.32
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	18.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.16
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	15.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.88
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.90
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.11

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.