Gene detail

Detailed information of OS493_028425-T1 in Lophelia pertusa

Genomic Location: scaffold_164:73793...88976
NR annotation: KAJ7383347.1, Phosphatidylinositol 4-kinase alpha [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028425-T1

ATGGCGGTCGACGGTCCTCGGCCAGCTGAATCTCTCCGCCATTTAGCCTGTTCTTTGGCAGCTTTAAACCCAGCGCCTTGGGAAAAGGTCAAGAAGCTAAGTCGCCTGTGTCCCGCAAATCCTGCTTCACCCACTGATGTATTTATCCTTGATCAACGTGGTACTGATGGCATTCTTGCTCTTGGATTGTTCGAGCTTCACTCCAATTTGCAATACAAGGAGAAGATAATGCCGTATTTGGTAGATGTACTCAAGGGCCTTCCAAATGCCAAATGGCTGGAGGCCAGGGAACCTGTTTCTCTCTCCAAGAGTCCTTTGGCGGGAGAGTTTGCGTTCTGTTTTGTGACGCTCATGAGCGGATTGGCAGCTAAAGATAACAGCTTGGACGGCGATATCATTAAAATGCAGCTCAGCTTGTTCAATACTCTGATCGAGCAGTGCTGCGCTTATCAACAGCTCCCTGATGTCAAAAAAGCAAACTTCTGTCGTACCACTGTCCCCCTCCTCCTCGGTGTAGCTCAAGCCCTGGGTGTGTCTAGTGTGTATGTGTCCGACCCCTCCCTGATCACACAGCTATTGTTTCCAACCCACTCTGGCCACGCCACACCTACAGAGCCTCAGTTACCAAGGGCGTTGAATAGATCCGCCCCGAGACGATTCCTGAGTTTTCCGCAGGGCAAGAGAGATGTCAGTTACCACTTGTCAGATGCGCAGTTGAATAACCTTATCACAAAGGCTGGAGTGTTGCTGAACAAATTCCCATTCCAGTCATTCAGTGAAGCTGTAATGCTGTCCATGGTAACACTATTGAGAGATCTCTGTCAGAATACTCCAGGTATTTCTGCTAGTGTTGCAAGCAGAGCCCATGAAGTAGGAAAACTGGTCTTCACAACAGTGAAAACAGAATTTCAGAAGAAATCAGAGAATACTGCTGCGTCAATGCCTTGGAAACTTCAAACTGTCTCAGCCAGTGTTGATTTGATGGTCTGGACAGCGGCTTTGCAAGATGAGCAAGATGGAGACACTCTTTGTCAGAACATTGCAGAGTTCTTGTGCTCCAACTTAGCAGTGTCCTTGGCTCAGACGGGCAGTTGTCTTTTCATATTTTGTTGCTTGGAAGGTCTTGCTACATTGGCTGAAAAGATACCATCGTTAACCAGCCCCGTGCTCAACTCCCTAAAAGATTTTCTCCTTCGGCCTGCTCCTCTGCTTGTAAAGTTGTCTGAATCTGCCAAGAAGCCGACAGCAACAAACATAGTTATGACAGTCTCATCAGACACAAATGACAAAGTCACTGTGGGTCGTTCTTCTGGTTGGAATAAAGATGCACAAGATTCACCTTATCACAAAGTAAGAAGGGTCACGCTTGACAGTATTTGCAGGGCTCTTAAGTCAGGGCAAACCATTGACGAGAATTGTGTTCAAGCCTTCCTGGCATCTGTAGCCAACATACTCTATATATCGGAAAGTAGTGATGGCAATTCCACACTGATATCAACAAGTGCCATCCTGACCTTGGGCCATGTGGCGTTCATGCTTCACTCTGTGCCAAAGACAACAGACTCTGTGCTATCGATCCTTCAACAGAGGTTCTGTCATCCTCCATCATCTCTCGACCCTCTGATTGTAGAGCAGCTAGGATACCTCATTCTCACAGGATCGGAACAGTGTTATCAACAGATAATGGGCATGTTTATGAAGATCACTGTGGATGCAGGTTCAATGGCGTATTCAGCTGAACCATCGATTAATGATAAAACAGAAGGTTACAGGCACTGTGGTCTGGCAGTAATCAACGCATATTCCAATGTAGCCGCAAATCTTGAGGGAGAGGCACAGTTGCAGGACTACTTAGTGCGTCTACTAGAACTGTTTGTACAGCTCGGTTTGGAGAGTAAGAGAGCTTCATCAAGTGCTGGGAACCTTGGCATACTCATCCCTGTCATATCTATTGCAATACAACGTCTCCCTGTAATCAGCGACCCTAAGCCGCGCCTACACAAGCTGTTCCGAGACTTCTGGCTGTACTGTGTTGTGATGGGCTTTGGTGTCGAGGGGTCTGGCATTTGGCCGCATGAGTGGTACGAAGGCGTTTGTCAGATTGCGTCTAAGTCTCCTCTGCTACTTGGCACAGGTCATCTGAGATCAGAACTGATGTATAACTCAGCATTGAAGAATGACTGTGCTGCTCCAGCTGAACTGAATGAAGTGCGTACATCTCTGCTCGAGATTTTGGGAAACCCTCCTGAGATCATCACATTGGTGAACAAGTTAAACTTTGGGCAGTGCACCTATTTGTTGTCAGTGTACCGCCTGGAATCTCTCAGGGTTTCATCAGATCCTGGAAAGTTTTACTCCATCTTTGACTACTTAGAGGACAAGGCGATTGAAAAAGATAAGGCTGGAATCTGGCAGTGCATTTCTGCTGTTGGAGACAAAGTTTTCTCAGTCTTTCTGAACGTAATGTCCAACAAGCCACGGACGACAGACAGAGAGACAGAACTGGAGAGGCATGCGCAGTTCTTGCTCATCAAGTTCAATCACCTGCAGAAAAGGATCAGGCGTGTCGCGGACAAGTATCTGTCTTCATTTGTCGACAAGTAA

Transcript

OS493_028425-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P42356	Phosphatidylinositol 4-kinase alpha OS=Homo sapiens OX=9606 GN=PI4KA PE=1 SV=4
O02811	Phosphatidylinositol 4-kinase alpha OS=Bos taurus OX=9913 GN=PI4KA PE=2 SV=2
O08662	Phosphatidylinositol 4-kinase alpha OS=Rattus norvegicus OX=10116 GN=Pi4ka PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002988 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19274 all species →	PI4K_N	PI4-kinase N-terminal region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR045495 all species →	Domain	PI4-kinase, N-terminal	Interproscan

PANTHER

No PANTHER signature was detected for OS493_028425-T1. This gene does have a gene model — the search simply returned no hit.

Gene Ontology

No Gene Ontology signature was detected for OS493_028425-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24815	HEATR6; HEAT repeat-containing protein 6	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028425-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

31.4Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	2.86	4.72
polyp at pH7 6	18	17	2.60	4.16
coral polyp · control treatment	16	16	6.52	26.62
coral polyp · oil and dispersant treatment	16	16	5.27	19.80
coral polyp · oil treatment	16	16	6.04	31.38
coral polyp · dispersant treatment	16	16	5.62	19.61
Polyp	10	9	1.19	2.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.72
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.61
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.40
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.03
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.02
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.93
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.66
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.16
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.90
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.21
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.09
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.88
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.78
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.54
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.39
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.17
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.09
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.38
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.62
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.47
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.97
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.24
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.18
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.59
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.51
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.11
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.25
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.80
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.12
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.09
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.50
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.06
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.26
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.54
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.18
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.69
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.55
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.98
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.58
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.16
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.39
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.88
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.61
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.41
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.14
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.54
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.48
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.48
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.31
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.55
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.10
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.54
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.13
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.06
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.80
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.