Gene detail

Detailed information of OS493_028432-T1 in Lophelia pertusa

Genomic Location: scaffold_164:164926...176367
NR annotation: KAJ7383354.1, Myb-like, SWIRM and MPN domains 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028432-T1

ATGGCGGAATCAGAAGAAGAAGTTGATGTCGAGGACATTTCCGATGGCGAACAAATATCCAATTTACGAGACTTGGCCGAAGACGATCACAAGGATAAATGGTATGACAATGTATCGGGTTTTATTTCTAATTTAAAGCTTTGCCTTGGTGATATAAGGTACGAGAAAGATATTGGCAATCAGAGTTTTTTGAACCCTTCTAATAGCCCATTTTCCTCAGAGTATTGTGATCCTAATTCGTGGCTTTTGGATACAAACTCGGTTTGGTCCTTAGATCCTTGTACCGATGACAAAAGTAGATCAGCCATTGAAAAAATGATTCTAGAAGAACAGTCAGTATCAATGAAGCTGGAACAATCACCCACAGCTGACAAGAGAAAACAAACTACTGTTGGAAGGACGTCAAATGCAAATGTTAAAAAGAGCATCATTAAGTCCAGAAAAGAGCAGCCTTCCTTGACTCACAGAAAACCTTGGACAATAGATGAACAGGAACTGTTTGAGCAGGGTCTGGGACTGTATGGACGTAGCTGGACAAAGATAGCGAACATAATTGATACTCGCACAACTCTTCAAGTGAAAAACTATGCCAAACAGTATTTCAGGCAAAAGAACAAAGCTCTTGTAGAATCTGAAGCAACCCAAGGGAGCATAGAAGATCAGTCCAAGGCCGACACATTTGTGGTAGCTTCTGATGTAGAACAGGTTGTAAATGAGAACAGTGTTTCAGAAGATGAGCAGGCTGTGCAGTCCACGTTTGTTTCTTCTCCTGTCGCTAAAGACAAACCACAATGTGAATCAGATGAAGACATTGAAATAGATGTTGATGGATCAGATAGTGAGGAGCTCAACACGCATTTAATTCCTGGTCAAACCACGTCTTGTCCTGAGGCTGTTTATTCAGCTCTTGTTCAAGCTGCAGCTGTAGAAAATCTGCAGGATTCAGTAAACCAAGAAAGCGATGTCGCCAGTTTAGAAGGGAATCCTGCTCTTGCAGCGCTCGAGGATATGTCGCCAAGTCCATCACAGCCAGAGATTTGCGCCTCTGTTATTGTCGATGCCAGGTGTTCTCTGAATGATGAAGAAATACCTCCGAGAGTGGATGAAACTCCACCACCCTCCTCTACCTTGTATGCTGGTCGTTTGACACGTGATTGTGAGGAAGATATATTTCCTGAGCGTCCGCTGCGTCTTCCTAATAACATTAGCAGCAACGTAAATGTGGTTCTTGAACACACTCGCTCGCTAAATGAAGAGACGGGTGAAAATTCTTCCGAGCTTGTGTCAAGTAAAAAATCTGTCGATGATCAAGCCTGCGAGCAAGCTCTATTGGAGGCGGGGTGTGGGGAAGAGAGTGATCGCGCCATTGGAATCAACGCTCCACTCGAAACGATTGATTCCAGTCCACAGCAACCACAGTTGTCCGATAGCAAGGACTGGGTGCCAGTGACATACGGAGAAGTTACCAGCTGCGAGCTCTTAGATTCTTCAGACCGCGAGCAGCCTGGGGCAAGCGTCACCTTTGAGAAGCCAATTGTTATCGACAGAAATGTTATACAAGACTTAGAAAAACAGCACAATGCAGAATTTTTCATGGGGCGAGCTCTCAAAACTCCAGAGCGGTACATGAAAATTCGTAACTATATCCTGGACATGTGGGAGAAGACCAACCCGAACTTTCTTTTTAAGACGGCCGTGCGAGGCGGTCTTCGGAATTGCGGCGATGTCAACTCTATTGGTAGAGTACACGCTTTCTTAGAAGACATCGGGGCTATCAACGAGGGATGCTTTGATAGACCAGTCCTCCGGGTCAGGCAACAAGGCGAGGTTACAGATGTAAAAGAAAACGTCCATATGGAATCCTGGGTAAATTCACTTAGACCCAGAAAGAAGCGACAGAGAAATGTGGATGGAGACTGGGTCGACTTTAGCAAACCGGAAGGGATGACGATACAGCACTTGTCCTCAGACCAACACGATCAACAAGAAGGCGTCCCAAATGAAAGAGGCTCTCCGTCAGTCCCCAGAAAAAGGCCCTCACGGAGCAAGCCCTCGTACGATCCGTTCCTTCTTGTTCCTTGTCGAAAATTTCCCTCGCCTAGTGCGGTGCCTTTTGATGTTCGTATCCAGTCAGAGACCTTGGTTGTCATGGACACGCATGCACATATGTCCACTACAGAGGTGATTGGTTTGTTAGGAGGAAACTATTCGCATGGGTCCAGAACATTAAAGGAATGGTTTGGCAAGGGCGGTGCACCTTTCATCGGTATCATTGTCAGCCCGTACAATTACAGTAATCCGTCCAACCAATCACAAATCAGATGCCTGACAGTTAGTGACGAGTGGGAGTCCGCTGGCCAGTACAGATTGCCGTATCAGTTTGATTATGAAGTCTTCCGAGACGAGTCTGACGAGGACGACACAGTCGAACAAGTCAAGAGCATAGCGGACGACTACAGACGATATCCCTTTCGTGTTCAACTCAACAGACGATTTGGTGCTTCTTCAAACTTGGACCTCTTGGATAAGCTGGTAGACTCATTACGCGCTCGTATAAGCAGCACGTCCGATGATAAAACAGAGGCATTCTTGAGCAGATTGAAAAATACGATCTCTGAAAACATCAAACCTCGTACACCCATCCCAGCTGACCAACAGAGTGAAGTCACTTTACAAGAATAG

Transcript

OS493_028432-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5VVJ2	Deubiquitinase MYSM1 OS=Homo sapiens OX=9606 GN=MYSM1 PE=1 SV=1
Q5RGA4	Histone H2A deubiquitinase MYSM1 OS=Danio rerio OX=7955 GN=mysm1 PE=2 SV=2
Q69Z66	Deubiquitinase MYSM1 OS=Mus musculus OX=10090 GN=Mysm1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008480 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04433 all species →	SWIRM	SWIRM domain	Domain	Interproscan
PF00249 all species →	Myb_DNA-binding	Myb-like DNA-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR001005 all species →	Domain	SANT/Myb domain	Interproscan
IPR017884 all species →	Domain	SANT domain	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR017930 all species →	Domain	Myb domain	Interproscan
IPR007526 all species →	Domain	SWIRM domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44042 all species →	DUPLICATED HOMEODOMAIN-LIKE SUPERFAMILY PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11865	MYSM1; histone H2A deubiquitinase	EC:3.4.19.-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028432-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

10.8Max TPM

2.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.71	5.96
polyp at pH7 6	18	18	2.57	3.99
coral polyp · control treatment	16	16	4.03	10.80
coral polyp · oil and dispersant treatment	16	16	3.07	5.56
coral polyp · oil treatment	16	16	3.76	6.52
coral polyp · dispersant treatment	16	16	2.21	5.13
Polyp	10	9	1.81	4.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.96
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.30
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.33
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.25
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.88
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.89
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.65
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.21
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.13
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.87
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.64
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.62
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.42
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.41
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.91
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.51
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.08
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.34
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.22
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.96
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.86
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.01
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.35
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.93
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.96
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.75
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.70
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.94
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.40
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.13
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.30
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.47
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.01
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.83
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.48
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.24
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.92
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.23
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.16
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.93
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.78
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.43
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.