Gene detail

Detailed information of OS493_028598-T1 in Lophelia pertusa

Genomic Location: scaffold_166:515333...534898
NR annotation: KAJ7370982.1, hypothetical protein OS493_028598 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028598-T1

ATGTTGGGTCTTGTTTTGCTGTTAATAACAGACAGAGAAGAGCTGCGCAGATCTGCTTCTTGGACCCTTAGCGGGATTGTTCTTCCTGAGGATCGCTCCAGAGGTCGCACAAAGCCATCGCTCTCAAAGAGGATGCTATCATTAGTCGAAAGTCAAAAGAGAAGAATACTCGTGTTCAGAAATGGAGAGAGCTCGGAAGGAGTGGAAATAGTGGCTGGACGATTTGATGAGTTCTTGGATGATTGTACTAAGAAGTTGAATCTTGAATCTGGAGCCAGGTTGTTATTTGACTGGCAAGGAAAGGAAATCAAGAGCTTTTCTGAAGTTCCAGTATTGGACAGAATCCTTCAGCCATCAGCCAGCGTCATTTTAGGGCCTGTTTGGGTGACTAGAGGAGGAGAGAGGTTCAGTCCTAAAGGAGCTTATCACTTCATTGCTACCCTATTACTGAGCACCAAGGACAGATTAAAACAAAGTAAAGCTTACAAACAACAGCTTGAACAAAGTCTTAAAGGTGAAGAAGTTGTCTCCAAAGAGATAATGGCAATGACTGAAGCAGAGATTGAAAATGAAATAAAAGAGGTTGACCAACACATCAGTGACCTGTCAAGCGTGATACCAACACTCCAGTCCCATCTGAGCATGGTGGAGACTGCGACACACGACGAGGAGTCAGCAGGTTTGGAGAATTACCGATATCAGCACTTGTCACATATCGCCCCCGAGAGCAGGCTGTTAGGAAAGCAGGGACTGAAATTAAAGGTGTTTGAAAATGGTTCCTCTGATGACAGAGTTGTAGTTTACTTCAATTTGCATGAAGCCGAGAAGGGAATCCAGGGCGATAAGTCTCAGTTGATGCATCGTTTTCTTGATGCCTGCACCAGCTGTCAGAAAGTGACAGACAGCGGCGGTGGGCCTGCTGGAAGAAGGATTGCCAAGAGAGTGTTTACAAGGGACGGCGAGGAGATTACTGATGTTCATGACTTGGTGTATGATCAAGACATATGGCTGTCTTATGGAGAGGACTTTAAACCACCTCATGTTGTTGGTCTTGAGCTGTGTTTAGACAAGGCTACATGCATGTCACTTTGGGGTGAGAAGGAAATGGTTCAAAGAGAAGGTTTTGACGATGAAGGCAAAGGGAAAGAAAAAGCTTCTCTTTGGAGAGCAGTCAATGGTTTTCCTTCAGGCAGCAAACGCCATCTTGTCACTTTGTTCAATGCAGGCAGTGAACTGTCTCAAGCACAGAATCTTCAGGTTATGCGTGTGGATGAGAACGGCTGCTTCCTGCAGTTTAAAGAAAAGAAGAACCTGGTACTTTATCCGGAACTCACTATTGTGGAAAAGAAGAAAAAAGGGGATAAAATGTCATGGCCTCCTGATGCTCAAGAGTGGGTAATAACACAGAGTGGTTTAATTCACAGTAAAGCTATGCCTCAGCTAGTACTGTCCAGATCAGAACATGCTGTCACTGTGAAGTATGCAGATGCATCTGTGGAGGGCTATCCTGTGATGATAGCAAAAAGGAATCCCAGAGACACCAATCAGCAGTGGGGATTTAGCCCAACAGGACGGATCTACTCTCTCTCAAAACCAAGTCTTGTGTTGACTTACGTTGGAGATCATGACGTCAAAGACATCTCCTCTGATGAAAAGCCTCCACAGCCCATCACACAAGAGCAGGAGACAGTACTCGGCTTGGCAAATCTAAATTTTATGGATGAACTAGGACTGAGTGACCAGATTTCACTTACAGAGGGTGCTAGTCTAGAGCCCAGCCCATCTCCGTCTGACGAAGCTGAGGAGAGTACTGAGACAGGTCTTGCACAACTTAAAGATGAGTTCCTTGGTCAAAGATACTCAGTTGTTCTTCTGCCGAAAAAGCATGGAGATGGTACTCAAAGATGGGCCATTAAACAGGAAGACTTGTTGAATATTGGCCAGTGGAAAAATTCCACCATTCCTAACCCAGAATGGAACAAGAGAGCTTTGTCGTGGCCAGTTAACGAGGATGGAACATGGAACACGGTACCAGACATAAATGAATCATCATCAATGGCCAAGGCATTTTTCTACCTTTTTTCCGTGTTTTTATCAAAAAAAGTTAGTTACACTTTCTCGGCAACTACCGGACTTTACGTGGCCCATGGAAGGTTTTTGCTGCCTTACGCTCCACCAGTTAAGAGGCCTTCACAAAAGAAGGTTGTAATGACAGGGACTCCTGCCAGATTACGAGTGTTAAAAAATGGTGAATCAGATCACAGTAGAGCTGTCACAGTTGTTGGTCCTGACTTGACTAATATGCTACATGATGTCAGTGGAGCAAGTTCAAACAACTCTATGAAAAAGCACAAAAGGCGATCTACTATTGACAAACGCGAGCATTCTGGCGAGGAACAAGCTGGCACTTGTCATCCCCTTGATCACAAAAGGCTTGAGTTGGATCTGTTCCTGGATAGGTGCACTGATGCTGTTGGCTTGCCATTTGCGGCAAGAAGGTTGTACACTGAAGGTGGAAAAGAAGTTAGCTGTCTATCAGAACTCCAGAGAAATGACTTGGTGTACGTTACATGTGGTGAGCCGTGGAGTGATCCAAAACTGTCATACTCCGAGCAGCAGAGAAGGGCAGTGCTGGCTAACCTTGCAGCAGACATCTCACACATTAGGCAGTACTGCACCTTGAGGGACCCTTCAGGTATCTTTGCTGGTGATTCAGACTGCGGCCTCATGAACTATCACTCATAG

Transcript

OS493_028598-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
M0R2J8	Doublecortin domain-containing protein 1 OS=Homo sapiens OX=9606 GN=DCDC1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003002 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03607 all species →	DCX	Doublecortin	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003533 all species →	Domain	Doublecortin domain	Interproscan
IPR000772 all species →	Domain	Ricin B, lectin domain	Interproscan
IPR043188 all species →	Family	Doublecortin domain-containing protein 1	Interproscan
IPR036572 all species →	Homologous_superfamily	Doublecortin domain superfamily	Interproscan
IPR035992 all species →	Homologous_superfamily	Ricin B-like lectins	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46302 all species →	DOUBLECORTIN DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0030496 all species →	Cellular Component	midbody	Interproscan
GO:1902412 all species →	Biological Process	regulation of mitotic cytokinesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_028598-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028598-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

66.4Max TPM

10.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.82	14.53
polyp at pH7 6	18	18	7.70	13.08
coral polyp · control treatment	16	16	14.21	66.36
coral polyp · oil and dispersant treatment	16	16	13.99	47.60
coral polyp · oil treatment	16	16	9.95	16.05
coral polyp · dispersant treatment	16	16	10.76	16.58
Polyp	10	9	4.57	10.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.45
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.30
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.28
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.22
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.27
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.36
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.67
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.09
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.08
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.99
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.86
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.81
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.13
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.84
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.62
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.48
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.03
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.12
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.21
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.36
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.74
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.51
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.90
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.57
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.21
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.56
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.19
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.56
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.27
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.25
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.70
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.92
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.35
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.20
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.95
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.28
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.23
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.84
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.62
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.55
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.46
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.05
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.75
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.07
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.73
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.36
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.79
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.74
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.36
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.23
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.28
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.58
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.80
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.90
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.58
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.98
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.94
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.93
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.98
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.03
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.89
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.40
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.28
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.28
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.14
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.