Gene detail

Detailed information of OS493_028743-T1 in Lophelia pertusa

Genomic Location: scaffold_168:458129...473537
NR annotation: KAJ7326020.1, hypothetical protein OS493_028743 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028743-T1

ATGAGTGGTCCATCCGTGACTTCCACAGGGGTCACAGCTTGTCTGGATTCGTCAATTCCAAGCCGGTCTAAAAATACCGTGTTTCTGGATTTGAGAAAACTAGAGGAACAAACTCCTCCACAGAGACATCAGGCATTGCCATCATCAATATGCAGAATACTTGGAATCAGTAATGACAGAGAATCTGATTCCTCCAGTAGTTCAGATGAAGAGGATACCCTTCAGTTCTGGCAAGATCAGAGACAAAAGGCTAAAGAAGCTTCCCTCTCTTGCGCAAGACAGAATAACGGCGGCCTTGACCACAGACAACCCAGGAAACCACCTGCAAAACACAGAAATGCTGTTGAGGAAATAAAACCTGCCCACAGGGAGATTCATGCAAAATTAAACAAAACAGTTGTAGGAGAACAGATTTTGAAGAAAGTGGACACACGCGAGGGTATTGACACTGGAAAGACACTGGTAGGGCGTGGTACTTCGACCAACTTACATAATGTAGAGCTCAATATAAAGGATGAGCATAAAGTGGCCAAAAATGAGAGTGAAGGCGCTGTGAAGCAGGCTTGGGTAGTTTCGGCTGTTAGCCCCAAGGACAAACCTTACAAAGATAGTGTCATCCAAGATGAGAAAAAGACACCAGAACAAGAGATAATTTGTCGCTCTACAGCAAAGAACCAGAATTTACCATCACCGAAGAAAGTCGACAGTGAAGCTGTCAACAGTAAGATCTCTCCAGGGAGAAGAGATCATGTGAGCAGTGTTGATAGTGAAGTCAAGACGGATTTGATTTCTTCTAAGAATGACGAGGTCAAGAGGACAAGTGTAAAACACAAGCAAGTGTTAACAGAAGAGGAGAAGGCTAAAAGGCAAAGACTTCAGAGGAGTCTACAAAATCTCAAGCCTCAGCTGTCATCCCACAATCATCACCCTGCTGCTCCTTGCACACCCATACTCTTTCATGAGGAAGCTTCATATGAAAGCCATGTTATCAGTCTACCCAGCCTTGATACAAGTAGCTCCTATCTACTGATGAGTGCCAAGCAATCCAGCTGTGGTGAGCTGACTGTCATCCGTCAGGGAGCCAGAGGAGGAACTACCCCAGCGACACACTGTTTCTCAAGCCTTGTAGCTTGGCTCGCCTGTTTAGTTTGTCCTGGTGTGAACGCGACAGACTACGCTGATGTATGCGGAGCACCGTTCTATGTGGTAGGCTTACAGCAAACTTGGCACGAGGGGCAGCTCAAGATAGAAATCGGTATTTGCAGCCGCGCAGAGAAAGGCGGAGAACACTCCAATGTGCAGGATGGGAAAGGCAAAATTAAAAGCAAAGCTAACAATTTGTTTAGGCACTCAGTGAGTAAGTTTCTCTCCACTAACACACTCCACAGTGTGTACACTCGCCTGTCAGAATGCACTCCCTGCCCATTCCAACACCTCGCGGAAATTCCAACAAGCAAAAGGAATTTATCAACACTGCTGACTGTCAATCCAGATCCCGAGGCGATGCAGCGCGTATTTGGCGGCACTAAACCCGGATTTTTTTGGCAAACCATGGAGATGGAAGATGCACCAAGTGAAGAAAAAACCGGCGCTAGACTGTGCCAAGGAGCCGAGATTCACAACACGGTCATGCTGATGCAGTACACTGTCTTCCACCAGCCTTTCTGTTTGCTGGATGTGTTGATTCGTGCTCGCAGCAAGGCTCTGGATATTGCTGGTCTCAGGCTGGTCTATCAGCAGAAAGGAGTGTTGGAAGAAAAACCAGCTTACGGATCTCAGTTTCCCAACACATCAGAAACGATGTTTACTGGGTCCCAGATCCCTGTTCTTGTTCTCGCGTTGCGTGGGCCCCAGGTTATCTCACAGTGGCAGGACGAGGTGGGGCCTGTGGATGCCAAACTCGCACAACGAACAGATCCCAACTCATTGCGGGCCTTGTACAGCGACGGGGCTAAGGAAGACCATCTGTTTTGGTGCCCGCGAAATGTGCAGAGTGCAGGAAGCGAGCTAGCCCGGTGGTTTGGGGGCCGGGTTCCTGAAAGTGGTGTTATTAACATTGGCTCTAGAGAGCCTCTTGCGACACCTGACGAGAAGCCTAAAGGGTCTCCCAGCAAAGCGCGTAATGCCAAGAGCCAGTTACTGACAAGCTCACTGCACAGCACCTGTAGACCACCGCCATACTTTTTGACTGCTTCCACTGATACTAGCGTGTTCTTGCTTGTCTCACCTGCACTTCCAGTTAGATGCCTTGGTCAAGTTCTGTGCGTTTGTTTCGACAGAGGTTTCTGCACTCAGGGTATCAGACGCGTCCATTTGAATACTAACCGTCTTAGTGGCCTGGGACTTGCACCGGAACAGCTATCCGTGTTCTGTCCCAAGCGTGTTAAACAATCAGAAAGCGGCTCTCCTTTACCAGTAGCATCTACAGTTCTGTTACTCAGAAGAGAGAATGCAATCCACCACACGCTATCAGTGGTTAAATCGCTCGTGGACTCCTTGGCACACGCCGGTTTGTCCCCGTCGTGCTTTCTATCCATTCCTTACAGCGACTCCATGTTCAAGCAGCTTGGAGGAGATTTTTCCCACACTCCAGACCCAACAGCTTATCCTGTCGATCTGTTGAGGCATGCATTCCACTCCAATCCTGAACTGGAACAAGTCTGCGTTGTGACTCTGCTGAAGGAGAAAGCCACCGTCTTCGCAGGCTCGATTCTGAAGCAGCTCCTGCTCGATAAGGACTTGCAGGGATTTGAAAATGGAAGATCGAATCCTAACTGTGAGTTTGAACTCTTGGGACTGAAGCTTCTCACGTCGTTATCAATACATCAAGCGAAGGAGATCACACCGTGTACGATTGGTGACGGACTATGGAAGAAAAGCCTGCACATCTTAACAAGAGGACCTGCGTTAGTCTTAGCGCTCAGAGGTGTTGACGCGTTCGCGCGGCTGCGACGCTTTGTGGAATCTCGTTTGGACTTGTCAAAGTCTAAACTCGCAACAGACAGCATTCCTCTAGACATGCTCATCTCCTGCACACCCGAACTGGCCTGCAGACAGCTGTCAGTCATTTTCTTTGACAGGGAGCTGTTCTCTGATCAATCCGCGCGTCGGAACCTGCACCTGCTCCCACCTCCTCGCCGAGTAATCAACGGTATCTGCAGTGGCAGTAGCGAATCGTTAAACGAAGCAGACGCACCGGGCGGGTCTTCTACCAACAGGAAGGCGAGGAACAGAAGGGTTGGGATGAACAAGTCTCCGCTAAAGGCGTCCCTTAGCAGCGTGGAGACGTTATGGTATGCAGACATGTCTGTCCTTAAGAGTTTGTTGGAGAAGCCTCGGGTCATACCCACTGTGTGTGTGTTGAAGCCTCGCACTGCAACCAAGCATCTCGGTAAGGTGCTCAAACGACTTGGACAGGAAGGATTTTCCGTGATTGGCATGAAAATGTTGTGCCTTTCTTCTGTAGCAGTTTCTACACTCATGGCTAAAAAGGAGAGGGACCTGGAGCGTCATGTACGTCACATGACTTCCGGTCCTGTAGTGGCTCTATGTCTGCAGCGCGAGAATGCTGTGGGGCGTCTTCTTGAGGTACTCGGTCCCAGTGATCCTCGTGTGGCAAAGAAACAGTCCCAGTTCTTTCTGAGGGGTTCGTTTGGCGAGGATTCCATTCAAAATGCCTTTTATGGATCTGACACTTACGAGGAGGCCATCAGAGATATCAAGATTCTGTTTCCTGAAGGAGTTTGTTGTCTTCCTTCCCTTGACCTCAAGGCAGAGGAGATTCCATGTCTCGCTCTGGATGAAGTATTCAGCGTGACGGCCAAAAGAGCGCTTGTAGAACTCTCCACAGAGGAGCAGAGTAGAGTGGATACCAGCCCTGGAATGATCCTGTTACCAAGCTCCTTACTAGAGATCAACTGTTTACTGTTACTGCCGCAGCAGCTGCTGGCTTGCCGCGCTCAGCCAGGGCGACGAGCGGCTAACATCAGCTACGCGGAGATCATAGAAGCTCTGCTCGCTGCAGGGTTTCACTTCATCGGCCTTAGAATGGTGTTGCTTGGAGTGGCGGAGGCTGCAGACTGTGCTAAGCTGTACAGCGGTTGCCTGCCGGTGGATTGGAAGCCTCATCACCTGGCTGGCCAACTCTCCAAGTCACCTTGTCTTGCAATGGCTGTCTTGCGTGACGGCGCTGTCACGTGTTACGACACGTTGTGTGACAGTTCGCCGAAACTGAGATCATTAGCCGCAAATTCCGGCAAGTACATGTTGGCAGGGAAGTCGCCAAAAGAGGCTAAGCGGATGGTAGAATGCTTCTTTGATCGCTTGATTCCCAACAGAAAAACCCGGATAGCGCTCGACCAGCCCTAA

Transcript

OS493_028743-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1L8EYB2	Dynein axonemal assembly factor 8 OS=Xenopus laevis OX=8355 GN=dnaaf8 PE=1 SV=1
B0USF1	Nucleoside diphosphate kinase OS=Histophilus somni (strain 2336) OX=228400 GN=ndk PE=3 SV=1
Q9QXL7	Nucleoside diphosphate kinase homolog 7 OS=Rattus norvegicus OX=10116 GN=Nme7 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009205 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00334 all species →	NDK	Nucleoside diphosphate kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036850 all species →	Homologous_superfamily	Nucleoside diphosphate kinase-like domain superfamily	Interproscan
IPR034907 all species →	Domain	Nucleoside diphosphate kinase-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43109 all species →	NUCLEOSIDE DIPHOSPHATE KINASE 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25423	DNAAF8; dynein axonemal assembly factor 8	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028743-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

179.1Max TPM

33.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.74	32.59
polyp at pH7 6	18	18	21.01	30.63
coral polyp · control treatment	16	16	45.97	179.14
coral polyp · oil and dispersant treatment	16	16	72.01	159.94
coral polyp · oil treatment	16	16	32.44	72.78
coral polyp · dispersant treatment	16	16	26.29	66.37
Polyp	10	10	9.81	21.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.33
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.60
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.98
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.44
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.75
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.67
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.28
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.05
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.61
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.17
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.63
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.87
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.09
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.89
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.11
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.25
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.44
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.74
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.72
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.71
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	179.14
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.13
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.96
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.69
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.72
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.59
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.91
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.05
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.74
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	159.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	110.01
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.99
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	75.01
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	69.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.92
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.87
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.51
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.99
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.33
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.78
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.93
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.05
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.05
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.35
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.93
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.99
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.83
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.49
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.68
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.37
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.19
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.08
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.78
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.60
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.31
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.95
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.57
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.35
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.09
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.88
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.21
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.75

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.