Gene detail

Detailed information of OS493_028775-T1 in Lophelia pertusa

Genomic Location: scaffold_169:73634...91331
NR annotation: KAJ7389807.1, hypothetical protein OS493_028775 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028775-T1

ATGGCGGCTGCCACTGCGCGGCAAATTCCCGTCGTAAATAACGTCATAACAGACGAAGATTTTGAAAATTTGCGGACCGAAGGAAAGCATTCTGGCAAACTCCTTCCAGTCAGCGTGCTCAAAACGCACAAACTTCTCACAGACAAACACTCGAAACAACTGGTAGATCGCCATGTACGAGCCATCCACAGGCTAACTAAATACTTCTGTCATGGATTTCTCATGAAAGATGTTGACTTGGTGTGTGATATGATCACAGTTTGTAGAGAAAGACTCGAGACAAACCTTCAATATGAGAAGCCTTTATGTGACTTGATTAAAATTTGTGGGAAGCCATTTTTGAAGGAAAGAACTTCAGACGACTCTACTAATGCTGATGCTATCATAAACCTTCTTACTGAGTTAGGGCACACTATGAAAGTAAACAACATCACTGTTCAACTGCAGTTAGGAGAATCACTGATAAGATTTTACACTGAACAGTCACCAGAGAGCAAGGATTTGAAGAGTTTAGAACAAGTTGAAGACCTGAGTGTACGACTGGAAATCATGAAAGTACTGCAGTGTTATTCAAATTCAGCACTGAACTGTGATGATATGCTGTCAGTTAGTGCGGCTGGTTTGTTGTGCAGTGGAATTAATATCCCAGACCCCTCTGACAGGCTTGTTTTCCGAACTGTGGAGATTCTCTGGAATTTACTGGAATTTGGCTCTAAACAAGAGGTTGCTAATCAACTAAGCTGTAAAGATTGTGTAAGTGCATTGAGGGATGCTTTTGTCAGGCAGATCAAAGAGGGTTACAGCCATGCTGACAAACAGCTGAGAAATGACTTGTTGGTAATTGCCTCACTGGTTGTGTCTCTCTGTCCAACCTCTCCTTTCATGGAAACTGGTTTCACCAAGCTGATAGTTTTGCTGGCGACCTTTACTGAGGTTAAAAGCCACCATGAACTGGTGAGAAATCTTAAACTGTATCAGACCCACGAGGACTTTGAGCTCAAGAAACTATTGATGAGCATTTTAGTGTTGCTGAGTGCAGATTCTGCCAGCTTTCAAATTTTTTCTGAGGGACGGGTTCTTCTGTCACTGTTTTCCTTTGTGCGGGCAAATGACAACAGCTCTACCATTGAGTGGTCCCCTGCACAGTTTGAAGAGTTGCAGTTACAGGATTACATGACATGTCAGAGTAACACCAGATTACTGATGCTACTAGAGTGGTGTGTAGGACAAGCTGACTATGGTGGTCATGGCAACAGTTTCCATGGCTCTGGTGGTCGAGGTAACAAGCGTGCCCAGATGCGGTATTGTTTGCGGCTTATCAGAAGCATGGTGTCAGTGGGAGATGATGGCTTGAATCAGGATCTTGTCGATCAAGGAGCCATAAATCAGATTGTTGGAATACTCCTGAATGCTAGCACCAGTCCTGATGAGAATGATACAATAGATGTGGAGATGCAGTGTGACATGCTGTTTATTGTAGCTTCTCTTTGTGAAGGAGACACACACAGAAAGGAACTGTTTGGTGCTCCAGGAGTTCAAGTGTTAGTTGAATATCTAAAGAGAGACCCAAACAAGATAAACAGTCCATTAGGACATCATCAGCTGCTCTTGTCGGGCGTGGACTGTGTGTGGTCTGCCGTGCTGGGATGTTATATAACCGAACAGCTTTTCCTTGAGAACGATGGAGTGTTTCACCTTATGGATTTATTAGAGATATGTCCGCCCACGATGCAGAATCTGGTGTTGGGCTGTTTGGTGGATCTTTGTGAGAATGCTAAGGCTCTTGCGCATGTGCAGTCCTGGCGTGGTGAAAAACAGATTTCAGCTGGTAAACTATTGGTGGAGCTGTGGAAAAAAGAGGAGTCAAACATGGGTGTAACACGAGATAAAACCGGCAAAATTACAGACCTTAAGCGGCCCCTCATTGGTACGGTTCAGGAGCGCCAAGGTGTCATCCCGCTACCCGCTGACCGGCCCAGCCAGGCGATCGTAGACGTGTCTGAAAATATGAGAGCTAAAATATACTCCATGTTTTGTAAACTTGGTTTTAACGCAATACCTGGTTTATCAACTCTGGATTATGTCACGGTGGCTGTAATTGAAAAATACCTCGACTTTAAGATGCTGGAAGTGTGGCACGAGATTAAGGTCGAGCTTGAACAAGAGAATATCAGACCTGTATCTCCTGATACTGACTCCATGATGGAAATCACCAGAATACTGAACGATAGAGCTTCAGGAGTGGCAGCTGCTCAGAATCAGTTGTTGCAAGCTCAACGAAATCAGGAACTTATCGAAGAAGAAGAGTATTATGAGTCCATCAAGGAAAACCACCGCCAGGAGGAAAAAGTGTTCAAAGATTTTTGCGATTATGTCGACAGAACATCCGACTACACAGTGCTAACGGCGGCGAAACGAAAGCAGTTAAGCGCCATAGACACTTCAAGACTTCAAGAAAGAGTGTTCACTAGTGAGCTTGCCCATGACACATTACAGGAAGATCTTAATGCAACGACTTTCTGTGGCAGACGAGTCGAAATCGAAAGTACCCCGCTTGAGTTAACTAGAGCAATCGTAGATACGACAGCCGTCGAAGAGGACAAGAAGACTCTTGTTGTAGCGTAA

Transcript

OS493_028775-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A5D8W1	Cilia- and flagella-associated protein 69 OS=Homo sapiens OX=9606 GN=CFAP69 PE=1 SV=3
B0CM26	Cilia- and flagella-associated protein 69 OS=Papio anubis OX=9555 GN=CFAP69 PE=3 SV=1
B0VXE6	Cilia- and flagella-associated protein 69 OS=Callithrix jacchus OX=9483 GN=CFAP69 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004506 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21049 all species →	CFA69_ARM_rpt	Cilia- and flagella-associated protein 69, ARM repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR048732 all species →	Family	Cilia- and flagella-associated protein 69	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR048733 all species →	Domain	Cilia- and flagella-associated protein 69, ARM repeats domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14716 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 69	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0097225 all species →	Cellular Component	sperm midpiece	Interproscan
GO:0097730 all species →	Cellular Component	non-motile cilium	Interproscan
GO:1902093 all species →	Biological Process	positive regulation of flagellated sperm motility	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24227	CFAP69; cilia- and flagella-associated protein 69	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028775-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

75.0Max TPM

18.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.19	22.28
polyp at pH7 6	18	18	12.60	19.14
coral polyp · control treatment	16	16	25.75	75.02
coral polyp · oil and dispersant treatment	16	16	21.15	73.43
coral polyp · oil treatment	16	16	21.38	32.05
coral polyp · dispersant treatment	16	16	16.23	28.28
Polyp	10	10	17.14	24.86

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.28
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.28
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.20
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.15
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.84
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.23
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.03
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.13
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.55
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.75
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.37
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.34
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.21
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.13
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.43
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.79
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.79
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.70
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.09
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.04
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.90
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.41
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.22
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.30
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.07
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.51
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.26
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.26
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.12
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.34
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.75
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.19
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.43
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.15
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.98
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.78
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.56
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.16
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.73
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.61
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.92
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.52
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.35
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.05
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.35
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.76
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.02
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.29
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.28
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.87
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.56
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.40
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.21
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.84
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.28
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.90
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.13
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.05
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.02
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.65
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.53
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.56
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.75
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.18
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.82
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.64
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.02
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	18.74
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.63
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	17.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	16.72
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.51
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.54

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.