Gene detail

Detailed information of OS493_028841-T1 in Lophelia pertusa

Genomic Location: scaffold_169:720167...730207
NR annotation: KAJ7389872.1, Peptide-N(4)-(N-acetyl-beta- glucosaminyl)asparagine amidase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028841-T1

ATGTCAAAGTGGAAGCATATCTCATCTCGTGTTCGTTCAAAGACTTTTGTTCCCGAGTCCCCGCCGCCGTCAAGTTACACTTTTACCCCAAATAAAGACGAAGTTATAGAATCAAGATTCCGGTTGCGTTACAGTACCACGTGTAACAGTTACTATAGAGACTGGTCTGACGCTATAGACCCATCCGCACAGGGGGTACTCCCGGGATGGGACAAGGCGCTTTACTCTGTGGACTCTGTGCATCGGCTAATCAACGAAGAAGTTGGACAGGTGTACCTAGAGAGGGTCCCAGGCTCCAATACAGGATGCATTAAATGGCACGTCAATTTTGGGTGCTGCGGTCTGCTGGTGGACGAGGTCACCATCAGGCTGTCATGCGTGGAGGACTTTGGAGGAGAGATTGTCGTTACACTGATGGGGAATCCGTCACAGAAACGAGTGAGGTACCCTATAGGGAGTGATTACGTCACATACACCGAGCTGGAGAATTCATCGGAGTTGACACTAACCGTTCATTTCGTTGGAGAGGCTGGCCAGGTTACTCGGCTATTTCCACAGAGTATATTGAGGGGCATGGGATATCCGCTTGACGTCCAGGTTATACTCAAGCCGCCTCTTCAGTCTTTGGGGAGACCCAGGATGCTTGTGGGGCTGCTCTACAGCAGTTCACAGGAAAACGAAGTGGATTCAAGACATTACAAGCAAAACACAACTAATACAGGCCAGGGATTTCTACATATTCACCTTCTCCGTGCAAGGATTTACCGCAAGGGAAACATGGCTTACCAGACGCCTTCTCAAAGTGGTAAGAAAAACAAAGACAAGAAAGGGCAAGGACCCATTGTGGAACGAACAGTATCTGATAGTAGGCGTGAATTACCACGACATCAAACGCCGAGCTCTGGAGATCTGCATCGCCGACAGCCATACGTCAGTCGGAAAAAAGGCGAAGTTCCTCGGAGGCATTCGGCTCAGTCTCGGCTACAAGGCAGTCGTAGCTGCGCGCAAACCAAACAAGTCAGTCAAGTGCTTCGGTTTCTTAAAGCGAAGGGAGGGGTGAGTGGGGGAATGAAGAGTGATAAAGAAGAGACTGTGGGGACGAGGGAGAGCAAAGTGTCTTTCAGCGACAAGGATACTGTGATAGCAAATGTGAATTTGAGTTTCGCAAAATGGAGGAAAGTGAGTGCAAGTGGGAACCCTGTGACAACTGTTACCACCGATAAGGGAGCCAAAGCGGAGATAGCTAAAGACGCAGAAACTACAGAAATGAAGGCGAAAAACAACACAGAAGGTGAGCAAATCACTAGCGATGAAACTACAAACGATAAAACTTCAGTTGACGCAACGAAAGCGGACACTGCCGAGAATGAACCGCAAAGCGCGTCTTCCACCAGCACGGAGGACATAGCAGCGGCCTGGGACTCAATCCCAGATCCCACTACGAATTCCCAGCAGGATTTGGACGCAAGCCCAGAAAAGTGCGCCAATGTCAGCGTGAAGGAGTCTGAAGTAACTGACTCGACAAGCGCAGTAGAAAACACTACAGCGGTGACTGAAGTTAGCTGTGGTTCATCAGTCTCCATGCAAGTGAATTCCAAGAACAAGCACTCAGTAGAAGAGCGACTGTTCCGTTCAGTAATGACCTCCATCAAGCAACTGGACTTCGAAGCTCGCTACAGCGCCATGCCAAAAGACTGCAGCGATGGAAAAGAGCTCGAATGCTTCAATGAGGACAGCAAAGGCGACGATCAAACAGTAGTTAATTCCTGTTCTAACGAGGATTTTGAAAAAGGAGAAGTCTTACCGACGAGCGATGGTCTTCAAAATGAAGATGTAGGGAAAGAAGAGTTGGAGAAACAAGAATCCTGTGAAATTTCCAATCAGATTATTGAAAACGACGCAGAAAAAGAAAATAATGGTTTGAACGAGATTGAAGCTGTACAGAAAGGTGATCTAGCTGAGAACACACCCGTGTTAAATGACATAAACACAGCAAACGAGATAAAGGAAAGTGGGAACGGAAATTCGCCGGAATTCTCCGAAAATTCCCGACAAGAAGATGATCAAGAGAAGAATGATTTGAAAGAGATTGAAACTCAATGTAATGGCGATCTGACTGATGAAGTATTCGTTTTAAATGAAATTAAGGAAGCTAACGTGGTTAAAAACGCCGAAAGCGAGAAAGAAAACCCGTCGAATTCATCCGAAAATTCCGAACGGAGCACGAGCAAAACCAAACAAGCAAAATGA

Transcript

OS493_028841-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004599 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04721 all species →	PAW	PNGase C-terminal domain, mannose-binding module PAW	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006588 all species →	Domain	Peptide N glycanase, PAW domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR038680 all species →	Homologous_superfamily	PAW domain superfamily	Interproscan

PANTHER

No PANTHER signature was recorded for OS493_028841-T1 in Lophelia pertusa.

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006516 all species →	Biological Process	glycoprotein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_028841-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028841-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

103TPM > 0

7Conditions

4.6Max TPM

1.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	1.67	3.33
polyp at pH7 6	18	18	1.48	2.98
coral polyp · control treatment	16	16	1.22	2.38
coral polyp · oil and dispersant treatment	16	15	0.92	2.03
coral polyp · oil treatment	16	16	1.54	3.61
coral polyp · dispersant treatment	16	15	0.70	1.55
Polyp	10	7	1.89	4.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.33
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.60
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.22
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.73
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.55
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.17
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.12
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.65
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.98
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.43
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.80
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.71
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.61
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.44
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.42
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.27
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.01
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.95
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.60
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.38
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.25
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.07
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.55
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.46
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.24
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.57
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.48
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.00
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.91
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.88
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.86
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.71
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.61
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.46
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.27
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.61
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.76
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.63
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.46
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.27
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.24
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.11
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.01
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.93
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.82
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.15
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.86
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.60
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.43
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.62
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.24
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.63
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.75
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.