Gene detail

Detailed information of OS493_028969-T1 in Lophelia pertusa

Genomic Location: scaffold_172:393511...417231
NR annotation: KAJ7370898.1, DNA repair protein rad50 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_028969-T1

ATGTCGTCCTTAGAGAAGATGAAGATTCAAGGAATCCGTAGCTATTCTCATTTAGAGCCAAGTGTTATTGAGTTCCAGAAGCCATTGACATTGATTGTTGGACCAAATGGAGCTGGAAAGACGTCAGTTATAGAATGCTTGAATTACATGGCCACAGGAGACATGCCTCCAGGGAGCAAACAACAAATGTTTGTTCATGATCCAAAGGTTGCTGGTGAACATGAAGTACGTGGTCAAATTAAGCTCAAATTCAGAGATGTCACTGGTAGTCCTATAGTTGTAACACGGACATTGTTATCTCAACAAAAGGGTAAAAAGCTAGAAACAAAGACAATGGAGGGAAACATCATGCGAGAAGTCCACGGGGAGAGGCGAAGTTTGAGCTCCAAGTGTGCTGATATCAACAGAGAGATGATTTCATTCCTTGGAGTATCCAAAGCTGTGTTAGATAATGTGATTTTCTGCCATCAAGAAGAGTCTAACTGGCCTCTTAGTGAGGGAAAAGCGCTGAAACAAAAATTTGATGATATTTTTGCAGCCACAAGATACATAAAAGCTTTGGAAGCAATTCGCAAATTTCGACAAGAACAGACCCAAACTGTGAAAGAGTATTCCATAGAATTGAACCACTTAAAGGCAAACAAGGAAAAAGCAGAGCAGATAGCAGGTGAAATGACAGAAACCCAAGGCAAGGTTGAAGCAACCAAAGATACAGTCAAAGGTCTGAATAAGAAACTTGAGCCAGTAGAGCTGAGGCTAGCTGAGCTTGCAAGCATTGCAGATGATGTATTTCAGCTTGAGAAAAAAGTTGAGTCGTTGTCGACAGAAAAGAAGCAACTCTTCAAAGTAGAGGTGGATCTCAAAGACAAGATCACCAATCTCTTCAATGGATCTGTAGAGGAACTGCACCAGATTTTTTCAGAGTTTCAAACACGAGTCATGGAAAAGGAAAGAACCTTGAGAGATGATGAAGGTAAATTACAGAAGTTGAACAAAGACCAGCAAATACTGACTGCTGACCAGAATCAGCTGCTGTTGGATCATGGGAAACTTGAACAGAAAGCTCAGAGACACAAACAGAATCTAAGTGATAGAGACCAGGCCATCATAGATCTTGCTAAGGAGTATGACTTCAGAGACTTTGAAAAAGGACCCTTTCCCGAGGACAGAGTAGATCATTTCGTTGGAGAATTGAAGAAGAAATATCAAACCGTTATTGAAAAACACAAAGCGCCAAAGGGTAAGCAAATGCAAGCATTTGACGAGAGCTTGAACAAAGTGCAGAGGAAACTTGACGATATGAAGAAAAACCAAGCGCAGTGCGAGGAAACTATTCGACTCAAAAACAAACTTATGAGGGAAAATCAACAGAAGCTCAGGCAGATCGGCCAGGAATTGAGTAATGTGGATGCTTCAGCTAACAGACTGAAATCACTGGAGGAAGAGCTGCAGCGGGCGGAAAGAGAGCTTGAAGGTGCTCAAGAAAGTGGCAATGTTAATGAGTTGGGCAAAGATATTGACAAACTGCAGGCTGAAAAGCGTAAAGTTGACAATGAACTGCGTCAGTTAAGAGAAGAACAGCAAGCGATGCACATGCAGTCCACAACACAAGCGAAACTGGACATGCTGTCCAAAGACAAGAGCAGCAAAGAGGATGCTATTCAGAAAATTATGGACCGTCATGATGAAGATCTGAAATCCACGCTGGGCACACGTGGCACGTCAGAGAGCCTCTACACGAGATTACAAGAACACTTGCGAGTGAAGGAACGAGAGTTGAAGGAAACGAGAAACAAGCTACAGAAACTGAAACAACAGCTGTCTTCCAAGCAAACACATAAAAGAATGATCACAGAAACCTTACAAGGCAAGGAGAATCAAGCACAGCAGCATAGAAGGCAAATTTCTGAAGCCTGTGGAGAGAATGACTATAACACCACAAGAGAAGATATCCGAACTAGCATCGCCACACTACAAGATGAACGAGGCATCATTGGCTCGTTGGAGAAGATCTACTCTAAGTATGTCTCTAAACTGGAGGGTGAAGATGTGCACACAAGTGGCTGTCCTCTGTGTCATAGGACGTTTGACAGCAACAGGCAGATTGCTGGTCTTGTCGCAGAGCTAAGAAATAAAATTCGCACTCTTCCAGAGAAAAGAGTGTCAAATGAAATGAATCTTTCTAATGAACAACAACGCTATGATCATATTCTAGAACTGGCACCAGCTAAAGAAACTTTGGAATCTCTTGAGAACAATGAAATCCCTGATGCTAAATCCAAATTGGAAGACATGGAAAGAGACGTGCAAAGAATTGAAGACGAGATCACAGAGCTGGAAGATCTTCAGAGTATAACTGAAAGCGAGGAACAGAGTGCTCGAGAAATGGAACCAGACATTCGTATGTTGGACAAATACAAGTCGGAACTGAAGGATATGGACAGGAATATATCTCTGCTGCAGTCTAAGCTTCATGGAGTTGCTCCTGGACGTACCATGCAGTCTGTTTCTAACGATATAGCAGACAGACAAGATCGATCTGACACTCTCAATAACAACATTGACCGAAAAAGAACTCAGCTGAGCCAACTTCAGCGGCAGCTGAGTGAGCTGGAGAAAAACGTACATGAACTCAAGTCACAGAAGCTCCGACTGAAAGCCCAGTTACAGACGAGAACACACTTGGAACAACAGAAAGCTGAACTCACCGCAAACAACAGTGCCTTTACAAGAGAGATTAAGGAAGCCGAGAAAGAACTAACTCCTATTGCGACCAAACTTGAAGAGCTCCAGGCTGATAAACAAGTCGTTGTCGATCAGAAGGAAGCTGCAGACGATGAGAACCGCAAGATGCTAAACGAAATAAGAACAAGTGGAGACAAAGTGCGTGAAAGAACCGCTGAAATAAGACGGTAA

Transcript

OS493_028969-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9JIL8	DNA repair protein RAD50 OS=Rattus norvegicus OX=10116 GN=Rad50 PE=1 SV=1
A0A1L8GXM0	DNA repair protein RAD50.L OS=Xenopus laevis OX=8355 GN=rad50.L PE=1 SV=1
P70388	DNA repair protein RAD50 OS=Mus musculus OX=10090 GN=Rad50 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001857 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13476 all species →	AAA_23	AAA domain	Domain	Interproscan
PF04423 all species →	Rad50_zn_hook	Rad50 zinc hook motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004584 all species →	Family	DNA repair protein Rad50, eukaryotes	Interproscan
IPR013134 all species →	Domain	RAD50, zinc hook	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR038729 all species →	Domain	Rad50/SbcC-type AAA domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18867 all species →	RAD50	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000722 all species →	Biological Process	telomere maintenance via recombination	Interproscan
GO:0000794 all species →	Cellular Component	condensed nuclear chromosome	Interproscan
GO:0003691 all species →	Molecular Function	double-stranded telomeric DNA binding	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0007004 all species →	Biological Process	telomere maintenance via telomerase	Interproscan
GO:0030870 all species →	Cellular Component	Mre11 complex	Interproscan
GO:0032508 all species →	Biological Process	DNA duplex unwinding	Interproscan
GO:0043047 all species →	Molecular Function	single-stranded telomeric DNA binding	Interproscan
GO:0051880 all species →	Molecular Function	G-quadruplex DNA binding	Interproscan
GO:0070192 all species →	Biological Process	chromosome organization involved in meiotic cell cycle	Interproscan
GO:0090305 all species →	Biological Process	obsolete nucleic acid phosphodiester bond hydrolysis	Interproscan
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_028969-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_028969-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

24.0Max TPM

6.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.53	13.68
polyp at pH7 6	18	18	6.00	13.18
coral polyp · control treatment	16	16	7.43	23.97
coral polyp · oil and dispersant treatment	16	16	5.78	14.69
coral polyp · oil treatment	16	16	7.80	18.36
coral polyp · dispersant treatment	16	16	7.09	15.50
Polyp	10	8	5.63	15.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.68
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.07
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.62
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.50
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.73
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.65
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.03
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.82
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.19
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.47
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.25
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.63
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.61
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.42
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.50
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.50
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.92
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.21
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.20
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.41
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.78
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.75
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.26
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.03
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.85
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.84
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.81
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.64
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.24
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.10
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.52
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.17
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.54
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.85
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.43
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.61
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.70
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.47
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.48
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.42
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.02
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.61
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.97
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.07
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.86
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.77
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.69
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.48
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.67
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.89
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.11
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.