Gene detail

Detailed information of OS493_029114-T1 in Lophelia pertusa

Genomic Location: scaffold_174:315679...332988
NR annotation: KAJ7325688.1, hypothetical protein OS493_029114 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029114-T1

ATGACCGTCTTGAAGCTGATGTTGGAGAAACATGGCCCTGATGTTTACTTCAACTTTTCTGGTCAAGAGGGAGGGGCCATCACTTTGCCACCCATTTCAAAATGGCCACTACAGTCAGGTTTTACTTTCTCAACATGGCTGTGTCTTGATACATCGCACCTGGCAAATGCTGAAAAGTGCAAACCATACCTCTACTGTTTTCGGACTGGAAAGGGTCTTGGTTATTCTGCGCATTTCTCAGGTCCCATGCTGGTCTTAGAATGTGCTGTTAAAACTGGAAAACGGGAAAACAAAGTGCACCATCACCTGGTGAAGTTTGAATTTCACCCTCAAAAGTGGTACATGGTCACAGTTGTGCATGTGTATAACAGATTTCATTCCAGCGAGATCCGGTGCTTTGTCAATGGAAAAGTAGTATCCACAGGAGAAACAACTCTGGTACATGCTAACGAGCCATTTGACAAGTGCTACATTGGTTCATCGCCCAAGGCTGATGTCGAGAGCGTATTCTGTGGTCAAATGGCAGCAGTGTATGTTTTTTCCGAGGCTCTTACTGCCCAGACTGTTGGCGCAATACACAGACTGGGGCCTGGTTATAAGGGCCAGTTTAAGTTTCATGCTGAAATTGACACTCCTCTATCAGAGCAAGACAGAAAGGTGTTATATGACGGCCACTTGTCAGCCGTCATCATGTTCATGTACAGTCCCAAAGCTTGTGACCAGCAGTTGTGCCTCGAAGCCTCGCCCACCGAGAATCCGTCATTCTTCTGCCATTCACCGCATGCTCTTATGTTGGAGGGAGTGCAATCTGTTGTCACGCATTCTCTTCAGTGTATTCTGCACTCATTGGGAGGAATTCAAATGCTGCTGCCGTTGTTCGGTCAGTTGGATTTCCCTCAGGAAGGAGTTGAAGACACCAGTGAGGTTCCTGAAGTAGCAATATGTACTGTGCTTCTGTCGCTTCTGTCCGATCTTCTGAGGAGTTCCTGCACCAGCCAACAACAGATGATTCAATGTCAAGGCTTTCTTGTCATCAGTCACGTGCTCGAAATGACATCTTCTAAGCTGGTCAGGATCAGGAGACCTGTTAGGAAGTCTGCTGGATCACATTCTTTTAATCCAAACTTGTGGGTCAAAGCATTGCCGAAGGTTCAACTTCAATTATTCAGTGTTTTTGCCACTGACCTGGCCACTGGTACAGGCTGCGCTGCTCATCTGCGCCGCGATGTTGGTGTCAGCAGACTTATGTACATGCTAAAGACATTTACTGGCTTCACGATGCCACTGAGTTGGAGCAAGGAGAAAGGCATCACAGAGGAAGAGTTCAAAAGCATTCTGTCCTATCTTATGATAACAAATGAGGAAGAGAACCTACTGGATGTACTTCAACTGGTGCTGTCAATTATGACAGAGCAACCGGACACTTGTATTCCTGTCTTTGACAAAGTGGATGGTCTGAGGGTTTTATTTCGCTTCCTGGACATGAAGGCTGAAGCAGTTCGAGTGTATTCTTTGAAGATTGTTGGCTGTTTTCTGCAGTTCTGCCCTGCAAAGAGAAAACAAGACTTATTGGAGCACTACAGTTTATTCTCGTTGGTTGGCGACAAGCTCATGAAACATTCTCTGACGCTTACCACCTACAATGTATTGTTTGAGATCTTGGTTGGTCGAGTCTCCAAACAGATAGTCAGCGGACATCACCCACAGCCTGACAACACCTTTCTGTTAAACAATACAACTATGGCGCCGGTCATTGCTAAAATGCTGCGTAAAAATGAAGGAAAACAGTGCAACGCAGGAGTGAAGCTGACACGGCAGGAAGCTTCAAAGAAGAACGAACTCCAGATGAGGAGAAGATCGACCTCAAGAGAAACCTCATCCTGCAGTTGTCGTGTTGGCAGGATTGGCTTTTCTCTTTGGCTCATTTGGAACCTTCAAATGCAGAGGAAACCCGCACCACAGACACGGTGTTTTGTCTGTTTCGTATGCTACTGCACCACGCCTTTCAGGAAGAACGGGAAGGTTGGAGGATCTGGGGTCGACACTCTGGCTATTCTACATGGCAAGGTGAGTGCATTTGAAAAAGAAAAGGAAAGGAATCACCCTAAAAGAGTGGACCTAAGCTCTCGTGATGCAGGAAGCAGCCAAGAACAAACCCAACCAGGAGCTGCATCAAAGTCGGCGGATTGTGACACCGACAGAAAGAAATTTTTCCAGTCGCTACTGCAAGGTAAAAATGGACAGAAAGTTGAAGCAACTGTTCCTAACACCATCCCTGAGGAAAGTGAAAGCGAGCCTAACTCCCCCTCCCGTGGGGAAACGCTAGCTAGCGGCGATGATTCCACAGACATCATTCACAGCGAATGTAATGGGAACAGAGATGAAACGCTGGAACATGTTGAAGAAAAGTCCTCCACGGTGGAGGACTCCCTCAGCGCTACTGGTGTTAGCTCCGACGTCCAGAGGGGCTGA

Transcript

OS493_029114-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9ESE1	Lipopolysaccharide-responsive and beige-like anchor protein OS=Mus musculus OX=10090 GN=Lrba PE=1 SV=1
P50851	Lipopolysaccharide-responsive and beige-like anchor protein OS=Homo sapiens OX=9606 GN=LRBA PE=1 SV=4
Q8NFP9	Neurobeachin OS=Homo sapiens OX=9606 GN=NBEA PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002506 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13385 all species →	Laminin_G_3	Concanavalin A-like lectin/glucanases superfamily	Domain	Interproscan
PF15787 all species →	DUF4704	Neurobeachin/BDCP, DUF4704 alpha solenoid region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR031570 all species →	Domain	Neurobeachin/BDCP, DUF4704	Interproscan
IPR050865 all species →	Family	BEACH Domain-Containing	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13743 all species →	BEIGE/BEACH-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008104 all species →	Biological Process	protein localization	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0019901 all species →	Molecular Function	protein kinase binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029114-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029114-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

15.7Max TPM

7.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	5.32	11.02
polyp at pH7 6	18	16	5.18	8.31
coral polyp · control treatment	16	16	10.17	15.72
coral polyp · oil and dispersant treatment	16	16	9.19	14.54
coral polyp · oil treatment	16	16	7.81	13.06
coral polyp · dispersant treatment	16	16	8.67	12.64
Polyp	10	10	1.92	3.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.10
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.40
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.34
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.29
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.51
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.86
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.59
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.51
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.13
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.75
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.51
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.47
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.72
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.57
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.55
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.81
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.39
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.31
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.76
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.61
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.98
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.08
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.70
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.54
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.86
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.62
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.27
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.04
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.77
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.54
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.73
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.81
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.50
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.63
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.25
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.42
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.36
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.54
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.54
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.19
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.32
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.45
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.24
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.82
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.63
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.29
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.72
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.66
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.71
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.76
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.28
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.23
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.96
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.61

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.