Gene detail

Detailed information of OS493_029119-T1 in Lophelia pertusa

Genomic Location: scaffold_174:353225...367230
NR annotation: KAJ7325693.1, hypothetical protein OS493_029119 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029119-T1

ATGTTCAAGTTTGCTGATCAGCAGACCGTGAGGAGAGTGGTACGAGCTCTCCCACCTGTTGGAGTCGGTATATATTATGGGATACCTCAAACCAGGGCGGCATCATTGTATTCTCCTCGCCAGCTTTTCCAGAAATCCACCATGACGCATCGCTGGCAGAAAGGAGAAGTGTCCAATTTTCAGTATCTCATGTTCCTCAACACTATTGCCGGTCGAAGTTTCTGCGATCTTAATCAGTACCCAGTGTTTCCGTGGGTTCTGACCAACTTCGAGTCTGACACGCTGGATCTGACGGACGCCAACAACTACAGAGATCTCTCCAGGCCCATCGGTGTTCTAAACCCTACAAGACATGCGCAGTTTCTTGAGCGCTATGCATCTTGGGATGAAAATGACGACATTCCTCCGTTTCACTATGGAACCCACTATTCCACATCCGGGTTCACGCTGGCTTGGTTGATTCGTGTGGAGCCGTTTGCGACTCAGTTTCTCAATCTTCAAGGCGGTAAATTCGACCATCCCGGTAGAACATTCTGTTCTATTATCCGCTCTTGGAACAATTGTCAACGAGACACGTCAGACGTCAAGGAACTTATCCCTGAGCTGTACTATCTTCCAGAGATGTTTGGGAACTCCAATAATTTTACGTTTGGTATTGATGATGATGGAATAGTCATTGATGACGTCGAGCTTCCCAAATGGGCGTCAACTCCGGAGGAATTTGTCATGTTACACAGAGCTGCTTTAGAATCAAAACACGTGTCTGCTCATCTGCATGAATGGATCGATCTCATATTTGGATTTAAACAGAAAGGTCCTGAAGCGGAGAAGGCCACCAATGTGTTTTTCCACCTGACTTATGAAGGCAATGTTGATTTGGACTCTATCGCTGACCCGATCATGAGAGAGGCTGTTGAACAGCAGATCAAGAGTTTTGGTCAAACTCCGTCTCAGCTGTTACATGACCCGCACATTTCAAGAATGCCCCCGGAACCTCAGAATATCGAAGAAGAGGAGCCATTTAAAAGTATATATCTGACTTTCAAAGTCACGGGTGACGTTCCAGTGACTCACGTGGCAGCCAACACGGACTCCACCGTCCCCTCCCCTGCTGTAGTAACGATCAGTTGTAACCAGTGCTTCTCGGTTAACAAATGGCTTACATCAGCTGACCTTAAGCAAAGTCTTCGAGGTGTGCAAGTTGAACAGGATCCCATGTTAGCTACATCCGCTGGCCGACAGAAGCGGCAGCTCGGTGAACCGCTGGACCAGTCAGTCACGCCGTGCGCCTGCTGTTTCGTGGTGACCGCTGACAACAAGCACATCATGGCTTGCGGCTACTGGGATAACAGTTTCAAGTGTTTCTCGGCGGATAGTGGAAAATTAACACAGTGTGTGTTCGGCCACTGGGACGTAGTCACGTGTTTGGCTTACTCACGTCACGTGGGTTTGACAGGAGGAGACGCGTTTGTCGTATCGGGATCACGTGATGCCACTGTGTTGGTTTGGCGGTGGAGCATGCGGTTTCAGAGAGTAGCGGCATCTGACCGCGCGGAGGGAGACAATCCTTCTCCCTTGGCTATTCTCACTGGACATGAACAGCCTGTTGTTTGTGTGGACGTCAGCGCTTCCCTGGGACTTGTAGTCAGCGGTTCACAAGAGGGGCCTTGCCTTTTGCACACCACGACAGGGAATCTCTTGCGAACTCTGCGAGGCCCGGGAGAGTGCGTCAGACCGAGGCTGTTGAAGCTGACCCGCGATGGCCTGGTGCTAGTTAACTACACAGACGGGACTGGTCATCTGGCGGTGTTCACGGTCAATGGCAGGTTGCTAAGCGACAAAGGGCTTGATGACCAGATGCTGGCATTGGCTCTCAATAAAGACGGGAATTTCTTCGTGTCCGGAGGCTTCAGCCGGTATTTGAGGGTGTGGCGAACGCATGACTTGTGTCTGCTCCACACGTACCCGCCATGTGACGGCAGTATTAGAGCTCTTACCATCTCTACCGATCAGAGGTGTTTGGTGGCTGGACTGGCTTCAGGCAGTATCTTGGCTATCGCCGTGAATTTTCCAGGTCGCCTTTGA

Transcript

OS493_029119-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NFP9	Neurobeachin OS=Homo sapiens OX=9606 GN=NBEA PE=1 SV=3
Q9EPN1	Neurobeachin OS=Mus musculus OX=10090 GN=Nbea PE=1 SV=1
P50851	Lipopolysaccharide-responsive and beige-like anchor protein OS=Homo sapiens OX=9606 GN=LRBA PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002584 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20426 all species →	NBCH_WD40	Neurobeachin beta propeller domain	Repeat	Interproscan
PF02138 all species →	Beach	Beige/BEACH domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036372 all species →	Homologous_superfamily	BEACH domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR046851 all species →	Domain	Neurobeachin, beta-propeller domain	Interproscan
IPR000409 all species →	Domain	BEACH domain	Interproscan
IPR050865 all species →	Family	BEACH Domain-Containing	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13743 all species →	BEIGE/BEACH-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008104 all species →	Biological Process	protein localization	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0019901 all species →	Molecular Function	protein kinase binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029119-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029119-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

46.2Max TPM

24.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.89	26.39
polyp at pH7 6	18	18	19.81	29.78
coral polyp · control treatment	16	16	33.62	46.23
coral polyp · oil and dispersant treatment	16	16	30.09	44.37
coral polyp · oil treatment	16	16	29.51	44.26
coral polyp · dispersant treatment	16	16	22.89	38.48
Polyp	10	10	10.55	18.59

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.39
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.18
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.45
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.76
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.58
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.47
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.68
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.45
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.15
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.42
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.97
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.83
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.78
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.77
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.62
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.82
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.03
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.96
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.62
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.08
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.86
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.45
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.23
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.23
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.03
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.45
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.60
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.76
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.86
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.78
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.15
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.91
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.48
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.47
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.09
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.83
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.20
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.89
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.02
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.64
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.20
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.28
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.15
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.21
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.26
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.44
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.48
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.21
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.75
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.66
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.02
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.46
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.25
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.74
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.48
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.44
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.43
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.50
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.69
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.24
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.79
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.46
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.57
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.14
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.53
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.72
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.82
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.71
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.86

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.