Gene detail

Detailed information of OS493_029133-T1 in Lophelia pertusa

Genomic Location: scaffold_174:463273...474805
NR annotation: KAJ7325707.1, Ubiquitin-protein ligase E3A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029133-T1

ATGTCGAACAAAAAAAATTGCTCATCGGATGGTAAGGGCGGCCTTAAGGAGTCCAGGAACTGTAACCAAGATCTTGATGGTGATGAAAATACGGACATGAAACGAGCAGCTGAGCAAAGGATCAAGAACTATTTTTTCCAGCTGACAGATGGCTGTGGTTCCCAGGAGTGTAACAATGAATATTGTGCATCCAGTGGCAGAAAGCAGACCTCGAATGACGACGCTGCTGCTTTAGCCTTACAGTTATTCATGAAGAAGGCTCGTCTTTGTGAACCTCTGCAAGAAAAAAATCACAAAGTTCCAACCAAAGAGGTCCCATTTCTCACAGAAAAATCATTCTTGTCGAACCTGAACTCTTGTGTGGAAGAAGGAAGCTACAAGAAACTTGTACACAGCATTGGTGACGTGTTTTCAAGTTCTGAATCATTGAACAAAAGTTTCTTGTTAGACTCCTCAAGAAAACAAATAACAGGAACTAATGTCGACATTGAAGCCATCCGGGAAATGTATTCTGCTCTGTTCAAGACAGGGGACTCCTCGGTGGAGAATTCATTAATAAACTCGCTAGTCGCCTTAGCACCGACTCTCGAAATGGATCTCCGATACAAGTTACCAAGCAATGATCCTAACTTCTTGAACCAATTTGTGATTATCATGGAAAACACAATGTTACACAGTCCGGAATATTTAGACCAAGCTCTACCTAGTTTCCTCAAGGCCTTGGTCTTACTCCCTGTGAAACTCCAAGCTACGTTAGTCCATATCTGGTCGCAGTTTTCAAGTCAGAAAATCAGACGCATGGTTGAAACTCTTCAACAGCTGATCACGTACCAAGTTTTAACCGGACCTAGCGCTACAGGTAATGCTCCGGTGCAAGAGGACGAAGCAATCGTGGCTGCAACCAAAACAATGAAACTGCTGAATTACGCTAGTATATTGGGAGGAATGTTTGATCAAACATTGTGTGACAGTCACGATGGAGCTGCGGCATCTAACAATCACGATGACCCTCTTCTTAAAGAATTGAAAATTAATGTCCTAGATTGTCGCAAACCTCTAGTTAAATTTGAAGAATTCGTCAATGAGCCATTAAATGACCAAATGGAAGTGGACCGTGACTTTACCTACTTTAAGCATGAAAATCAGAGCAAGTTTTCTTTTCTAAAGTACAACTTCATTCTGTCTACTGCTACAAAGTGCTTGGGTTTGTTTTACGACAATCGAGTGCGCATGTATAGCGAGAGACGGCTGACTTTGATATACAGTCTTGTGAGAGGCCAACAGGCAACACCATACCTTCGACTCAAGGTCCGACGAGACCACCTCATTGAAGATGCTCTTGTTAATCTTGAGATGACTTCTCAAGACGATCCAACAGACCTCAAGAAGCAGCTGTATGTCGAGTTTGAAGGAGAACAAGGGATTGACGAAGGGGGTGTGTCCAAAGAGTTCTTTCAATTGATTGTGGAGGAAATATTCAACCCTGATTATGGGATGTTTACTTTTGACGAGGCCACCCGTTACTGCTGGTTCAATCTGAACTCGTTTGAGACAGATGGACAGTTCTTTTTGATCGGTTTGGTCCTTGGTCTGGCTATCTACAACAACATCATTCTGGATGTGCACTTTCCAATGGTTGTATACAGAAAGCTGTTTGGCAAAAAAGGAACATTTGAGGACCTCAAGGATTCACACTCGGTTCTTGCAATAAGCCTTCAAGACCTGCTGGATTACGAAGGCGATGTAGAAAGTGAGATGATGTGTACATTCACAATTGGATACACAGACATGTTTGGCTCTTCGCTCACCAAGGAGCTGAAGGAAAACGGGGCAGAAATCACCGTTACCAATGACAACAGACAGGAGTTTGTGGATTTGTATGCTGATTTTATCCTCAACAAGTCCGTTGAGAGGCAGGATTTTGACTTTGATACTCTGGAGAGGTCCACTGAATATGACAATGGACTTACTGAGGGTTCAACCTTGATCAGGTGGTTCTGGAATGTTGTCCACAGCTTCACTATGGAGCAGAAGAAACAGCTGTTGATGTTCACGACAGGAAGTGACAGAATCCCAGTCGGCGGCTTCTCCAAACTTCGACTCCTCATCGCCAAGAATGGCCCTGACTCCGACAGGTACATGGCGCATGGAACTCCAACTATACCTTTCCCAGTTCAAATTGTCACCCAGGAAATGAACATGTAA

Transcript

OS493_029133-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q05086	Ubiquitin-protein ligase E3A OS=Homo sapiens OX=9606 GN=UBE3A PE=1 SV=4
O08759	Ubiquitin-protein ligase E3A OS=Mus musculus OX=10090 GN=Ube3a PE=1 SV=2
Q5RD78	Probable E3 ubiquitin-protein ligase HECTD2 OS=Pongo abelii OX=9601 GN=HECTD2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004925 (this species only)
Ubiquitin family	E3\|E3 activity\|HECT · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00632 all species →	HECT	HECT-domain (ubiquitin-transferase)	Domain	Interproscan
PF16558 all species →	AZUL	Amino-terminal Zinc-binding domain of ubiquitin ligase E3A	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042556 all species →	Homologous_superfamily	Ubiquitin-protein ligase E3A, N-terminal zinc-binding domain superfamily	Interproscan
IPR000569 all species →	Domain	HECT domain	Interproscan
IPR044611 all species →	Family	Ubiquitin-protein ligase E3A/B/C-like	Interproscan
IPR035983 all species →	Homologous_superfamily	HECT, E3 ligase catalytic domain	Interproscan
IPR032353 all species →	Domain	Ubiquitin-protein ligase E3A, N-terminal zinc-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45700 all species →	UBIQUITIN-PROTEIN LIGASE E3C	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0000209 all species →	Biological Process	protein polyubiquitination	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10587	UBE3A, E6AP; ubiquitin-protein ligase E3 A	EC:2.3.2.26	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029133-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

109.8Max TPM

27.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.78	23.59
polyp at pH7 6	18	18	16.49	23.18
coral polyp · control treatment	16	16	28.87	53.08
coral polyp · oil and dispersant treatment	16	16	53.73	79.43
coral polyp · oil treatment	16	16	24.32	38.34
coral polyp · dispersant treatment	16	16	38.00	109.76
Polyp	10	10	10.52	18.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.59
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.37
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.24
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.19
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.31
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.61
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.39
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.26
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.30
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.45
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.01
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.28
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.65
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.31
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.20
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.65
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.30
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.67
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.45
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.90
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.08
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.36
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.87
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.10
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.11
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.66
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.93
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.16
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.56
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.10
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.30
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.43
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.54
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.68
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.25
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.28
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.94
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.61
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.18
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.73
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.39
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.29
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.09
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.42
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.12
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.38
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.03
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.01
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.43
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.35
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.35
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.25
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.18
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.54
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.26
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.42
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.62
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.11
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.06
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.80

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.