Gene detail

Detailed information of OS493_029223-T1 in Lophelia pertusa

Genomic Location: scaffold_175:704503...706788
NR annotation: KAJ7389798.1, hypothetical protein OS493_029223 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029223-T1

ATGCCTGTAAGCAGTTCATTAGCGAACAAATTCACCATTCTGTACGGCTCTCAGACGGGTCAAGCCCAAGCCATAGCTGAGGAGATCCACGAATATTCGGAACAGCATGGTGTGCACTCGAACTTGTTTTGCCTTAGCCTCACCGAGAAAAAGTTCACCTTAGAGAAAGAAGCGGTTGTCGTGTTCGTGGTATCGACAACTGGTGAAGGCGACCCACCAGAAACGATGGGTAAATTCATGAGAAGATTAAAGAAGAAAACTCTTCCAGGTAATCATTTGGAAAATTGTCGATACGCTCTGCTTGCACTGGGGGACACCAACTACACAAACTTTTGTAACAACGGGAAGGCCTTGGACAAGAGATTACTGCAACTAGGGGCTCAGAAATTTTATGATACTGGTTATGCTGATGATGCAGTTGGTTTAGAATTGGTTGTGGAACCATGGATCGAGAGGTTATGGCCAGCATTGAGAAACCATTTGGGCCTACCAGCAGAGAAGTGCAGTGAGTTAGATAGTGTGATCACAGTTCCAGAAACCAATCATATCAAAGAACCAGTTGTCAATGGCCAGAGCAAATCATCAGAAGTCACGGACAGCAAGATCACAGCGGAGACAAGCAATGGACTTTCTCATACGACGGATTCTCAGAATGATGTTATGAATGTTCATGATTCAAACCAACAAGGCAGTGGTAAACTTGCTGATGCCGCGTCAGGAGCAGTGGTAAAGATAAACTCTGTTGATGATCAGAGTGCATCAGCAGTCAACGTTTCTCAGGACAGTAACATTGATCCTATATCATCACCCACTCTAGGAGACCAGCTGAAACAATCTGTTCCTCCCTTATCAACTAGCGCATTGTCTATACCACAACTTCCACCAACTTATTTAGAGATCAGTTACCATCCTGCGCGCAAAGTGGACTGTACAACATTACCCGTGCAAGGTGGTGCAAGCTTTCCTGGTGCAGTGACTGATGTCTCAGTGGCAACTGTAGTATCGGCGAGGCAACTAACACATAGTACTTCCATCAAGACTGCCTTGGATATAGAGCTTGACATCACAGATTGTAACATGAATTATGAACCTGGGGACTCCTTTGGCATTGTTTGTCCAAACACCAGTGCTGAAGTCGAAGAACTCATAACAAAGTTGGAACTGACCCAGAAGGCTGATATTCCTTTCTCCATTCAGTTGATTACATCAACAACCAAGAAGGCTGCTAGTTTGCCGAACTTCATTCCGGAGTACTCAACTATCAGACATACCTTGCTAACGTGCTTGGAGATCAGAGGTGTACCAAGCAAAGCTCTTATAAGAGTTTTGGTTGAACATACTAGTGACCCTAAGGAGAAGAGGAGACTTCAAGAACTCTGCAGTAAACAAGGTGCAAGCGATTATGCCAAGTTCATTAGGGGACCTTTGTCGTCCTTGTTGGATCTTCTTAATGCCTTCCCATCGTGTCGACCTCCGTTTGAAAGGTTACTCGAACTTGTTCCTCGCTTTAAGGCACGCCCTTACTCGGTATCAAGCTCTCCCCTGGAAAATCCCACTCGTCTTCATTTTGTTTTCAACATCCTGGAGTTTCCAACAGTTGAAGGAGTAAGGCAGAAAAGACAAGGCGTTTGCACTGGTTGGTTGGATGAGATGACTAAAGCTTTGAGGGAGGACACCATTGAAAGGAATGGCGAGCTGACTGAGAGCGTTTCAAAGTTATCTTTGCAAGAGTTACCATTTGTACCAGTATTTCAAAGGAAAAATCTCAATTTCAAACTACCAAGCGCTCCTGAGACACCGATCATCATGATTGGTCCTGGCACAGGGGTGGCACCATTCATTGGCTTTTTGCAACACAGGGAACACATGCTTAAGAGCTCTGACAGTGCAGAATCACTTTCTGAATCATGGCTCTTCTTTGGTTGCAGACACAAGGAAAGAGACTACCTCTACCGCCACGAGCTTGAGCGCTACCAGTCAACAGGTGTTCTGTCGCGCCTTTTCCTTTCCTTCTCCCGTGATACCATCAGTGACTTGTCCAGTAAACCTCCACCAAAGTATGTACAGGATAACTTGAGAAGTCATGCTACAGAGGTGGCCGAACAGGTCTTGAACAAAGGAGCGGTGGTGTACATTTGTGGGGATGCTGACAATATGGCAAAGAATGTGTTTGATACTTTCCTTGAGATTATTCAAGAGTACAAGGGAGTTGACATTGGGGAGGCAAGAAAGGAAATGATGAAGTTGCGTCAGAACAAGCAATACCTCGAGGACATTTGGACATGA

Transcript

OS493_029223-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8C1A3	Methionine synthase reductase OS=Mus musculus OX=10090 GN=Mtrr PE=1 SV=2
Q498R1	Methionine synthase reductase OS=Rattus norvegicus OX=10116 GN=Mtrr PE=2 SV=2
Q9UBK8	Methionine synthase reductase OS=Homo sapiens OX=9606 GN=MTRR PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006249 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00175 all species →	NAD_binding_1	Oxidoreductase NAD-binding domain	Domain	Interproscan
PF00667 all species →	FAD_binding_1	FAD binding domain	Domain	Interproscan
PF00258 all species →	Flavodoxin_1	Flavodoxin	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039261 all species →	Homologous_superfamily	Ferredoxin-NADP reductase (FNR), nucleotide-binding domain	Interproscan
IPR017927 all species →	Domain	FAD-binding domain, ferredoxin reductase-type	Interproscan
IPR029039 all species →	Homologous_superfamily	Flavoprotein-like superfamily	Interproscan
IPR008254 all species →	Domain	Flavodoxin/nitric oxide synthase	Interproscan
IPR001433 all species →	Domain	Oxidoreductase FAD/NAD(P)-binding	Interproscan
IPR023173 all species →	Homologous_superfamily	NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain superfamily	Interproscan
IPR003097 all species →	Domain	Sulfite reductase [NADPH] flavoprotein alpha-component-like, FAD-binding	Interproscan
IPR001094 all species →	Domain	Flavodoxin-like	Interproscan
IPR017938 all species →	Homologous_superfamily	Riboflavin synthase-like beta-barrel	Interproscan
IPR001709 all species →	Domain	Flavoprotein pyridine nucleotide cytochrome reductase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19384 all species →	NITRIC OXIDE SYNTHASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0010181 all species →	Molecular Function	FMN binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0009086 all species →	Biological Process	methionine biosynthetic process	Interproscan
GO:0030586 all species →	Molecular Function	[methionine synthase] reductase (NADPH) activity	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0050667 all species →	Biological Process	homocysteine metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00597	MTRR; methionine synthase reductase	EC:1.16.1.8	Cobalamin transport and metabolism	ko04980	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029223-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

34.8Max TPM

8.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.59	8.61
polyp at pH7 6	18	18	6.74	11.28
coral polyp · control treatment	16	16	10.09	18.44
coral polyp · oil and dispersant treatment	16	16	11.78	22.82
coral polyp · oil treatment	16	16	6.56	13.88
coral polyp · dispersant treatment	16	16	15.64	34.81
Polyp	10	10	3.57	5.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.61
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.68
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.66
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.95
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.66
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.35
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.24
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.16
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.57
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.26
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.21
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.93
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.89
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.09
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.90
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.42
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.44
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.67
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.26
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.02
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.75
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.60
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.81
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.85
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.06
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.83
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.82
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.43
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.29
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.94
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.84
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.73
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.87
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.57
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.86
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.11
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.10
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.56
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.33
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.12
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.86
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.41
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.81
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.32
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.19
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.41
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.07
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.49
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.86
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.47
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.99
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.41
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.37
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.13
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.26
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.18
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.25
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.