Gene detail

Detailed information of OS493_029239-T1 in Lophelia pertusa

Genomic Location: scaffold_176:100495...119786
NR annotation: KAJ7383274.1, Disabled 2-interacting protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029239-T1

ATGAACGACTCATCATGTGCACAAAATATGCAGATGTCTGGTATTTACGCGTCGGAGGCAACTCAAACCGTCAGGGCTATAACACGTGGTTTTTCGGCCCTAAGTCCCCCGCCTATCCCAAGATGGAGGTCACACGAAGCGCTGGATAGCAAAATGAAAACAACATCGGACAGCGTGGATCTGTCGATCAGTGGTCACGTGACAGTCCGTCCCATCCATCCCAGCATTCTCTCGAGACAACACTGTTTCCAAGTGACCACGCCTCATGAAACCAAGTACTTCTCGTGTCGAAGCTCGCAGGAGCTTGAGAAATGGGTTGTCAGCATCAAGAAATCGATCCAGCCGACAAGAGATGTTCAGTACAGGACAGACATTGGTCTAACAGTGTGGATTGTGGAGGCCAAAGGACTAACGGATAAACCCAAACGACGGTTTTACTGTGAGCTGTTTTTCGACAAGGTCATCTACGCAAAAACATCTTCCAAGACGAAGTCCGATATCCTTTTTTGGGGAGAAAACTTTGCTTTCAATGATTTACCTGAAGTCAAGACTGTTACGGTGCAAATCTACAAAGAAACTGATGGCAAAAACAAGAAGGAGAAAAGAAAGCCTGTCGGTTCCGTGGATGTGTCTGTCGACTCATTGGAAATGGGTGTTGAGGTGGAGAAATGGTACCCTGTTACCATGGAGAGTAACAAAACAAATGGAGGAGAATCCTCAAGCATTAGACTCCGATTTAAATATCAGAAAGTCTCCATTCTTCCAGTCAAGTGTTATAGTGAGCTATCAGAGTATTTAATGCGTAACTACATGACAGTTTGTAAAGCCTTGGAGCCGGTGGTCAGCGTCAAGCAAAAGGACGAGATCTCAAGAGTGCTTGTAAGAATACTACAAGCCTGTGGAAAAGCGACAGAGTTTCTTTCCAGTATCGTCATGGAGGAAGTCAAAAATTTGGAGGATGAGAACCTTGTATTTCGTGGTAATTCCTTTGCGACAAAAGCCATGGATTCCTACATGAAAATGATTGGTGAATCGGAAACCCTCGGAGAGTTTGTTCAGTCTGTGTATGAGTCTGAAGATGATTGCGAGGTCGATCCATCCAAGAAAACATCCGGGAACATTGATACCAATAAGGAGAACCTGAAAACATTCGTGGAGAAAGCCTGGAGCCAGATCATGTGTTCAGCCTGCCTCTTTCCTAGTGGATCAATCTTCCTGAGATTCTTATGTCCTGCTATTTTATCGCCAAGCCTATTTCACTTAGTACAAGAATATCCAAACGAGAGAACCTCAAGGGCTTTGACACTGATTGCCAAGGTCATGCAGAATTTGGCCAACTTTACAAGGTTTGGTGGTAAGGAAGAATATATGGGCTTCATGAACGGATTTGTGGAAAAGGAATTCGTAAACATGAGGAGATTTCTTGACGACATATCATCAAGATCGGACACCACTGAGAACCACTATGAAGGAATCATCGACAGTGGACGAGAACTCGCTCTTATGTTCGACATCTTAAAAGATCAGACCAGCAAGATGAACCAGGATGCCGTAGAGACGCTTCGCCCCTTGCAGTTTATCCTCAAATCACTCCAAGAGATTTATCACGATTCGGAGAGAAAATTTGCTCTTGGCAATGAAAGCCTATTGGCGCACAGGAAATGGGCATCATCCTCAGACCTTGTGCACGGTGATCAAGACAAGAACAACATCACTCTCACCCCTGTCTCGCAAATCAGGATCATGAAATCGCCCAGTAAAAGGACGCCAAGTCCCTCAATCGATACTTCTTCATCGGAACCTAATCTAGTTTACAACGGCAGCTCGTCGTTGACGACCACTCCAGAACAATTAATGGTGTCTCGTTTTGATAAGTCGATTCTCTCGCCCATCTCCGATATAGAGCCACCCGGTTCATTGCCAAGGAAACGGGTAACTCACGACGACGATTTACAAAGCAGTCTTCGTAGGCGCTCGTATCGGAGAGCGATCGCATCCGACGATCCTGCCAACGCGCTTCCGGGTGCAGTCGAACGTGACCGAAGTGCGTCCGAAAGACATCCGATGTCGAAAAGATCGGATTCACGTCGTCGATCGCGATCAGAGGGGCCTTTGATCATTTCAAGCGTGGATGGTGCGAGTCCCAGTGAAGCTCGAGTGATTTACCAAGGTGAACAATCAAACTCTACGTCGAGTTTAAGAGCATCAGATAGCGCTAACCAAAAACATTTAAGGGCCGTTGCCGAGTCGCGCCATAGACACGGGAATGATGGAAGCTTACCCCGAAGAAATAACTCTTCATTAATAACAGATCGATCTCGGACTTCGTCGCCCGAGAGAACGTCACCTCCGAGGCCATCAACACCAAAGCCACCGTCCCCACTTGCGTCAGTCGACTCGCCCCGGTCCTCTCCCCGATCGAGCAGCAGCAGCTCGACAAAGTTTCTGAACCCTGCTACGGGTCACGTGGTTCGCAGCCCGTCGCGAACCAGCAGCAGTTCCAGTGGAAGTGAGGAGAGTTGGCACAGTGTTGCGAGTAGCGTGGAGGGAGGGAGGAGAAGGGTGCGGAAGATGCCGCGGACACCCAGTCCAGAACCGGACAGGAGGCTCGGTTCAGGCACTCCTTGGGAAAGAATGGCACCAAAAGTCGAGCCGGAAGATTTTTTAAATGGCTATGATGTTCAGTCACCAAAGACAAGCACTGAGTACGAGAAAGAACTTGTTGACCTTCGCGAAGAGCTGTTAGAGACAAAGAGAACTCTGGCGTCGACCCATGAACAGCTAATCTTACAAGAGTCCAGCACTCACAAGCTAGTGGCTTCCTTCAAGGAGAGACTCGCGGAGAGCGAAAACAGCCTTCAACAACTGCGACTGGAGAAGGACAACGAAATGAAAGAGTTGCTTGACCGCTTGGTGAGCGTGGAAAGCGAGCTGCGCAAAGAGCAGAACGAAATGCAAGAAGTCATTCAAGCCAAGCAGGTTATTATAGAAGCTCAAGAGAGAAGGATCAAGTCAGTTGATTCGAACAATGCTAAGTTAATCGCTACGTTGAACCAGGTCAGGGGTGCAAGGATCAACAGCAAAGTGCTAAATTACCCTAGCAGCGACTTGTAG

Transcript

OS493_029239-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3UHC7	Disabled homolog 2-interacting protein OS=Mus musculus OX=10090 GN=Dab2ip PE=1 SV=1
Q5VWQ8	Disabled homolog 2-interacting protein OS=Homo sapiens OX=9606 GN=DAB2IP PE=1 SV=2
Q9UJF2	Ras GTPase-activating protein nGAP OS=Homo sapiens OX=9606 GN=RASAL2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002585 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF12004 all species →	DAB2P_C	Disabled homolog 2-interacting protein, C-terminal domain	Domain	Interproscan
PF00616 all species →	RasGAP	GTPase-activator protein for Ras-like GTPase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR021887 all species →	Domain	Disabled homolog 2-interacting protein, C-terminal domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR001936 all species →	Domain	Ras GTPase-activating domain	Interproscan
IPR023152 all species →	Conserved_site	Ras GTPase-activating protein, conserved site	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR039360 all species →	Family	Ras GTPase-activating protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10194 all species →	RAS GTPASE-ACTIVATING PROTEINS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0043087 all species →	Biological Process	regulation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029239-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029239-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

67.2Max TPM

21.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.06	28.44
polyp at pH7 6	18	18	15.54	22.44
coral polyp · control treatment	16	16	22.36	45.30
coral polyp · oil and dispersant treatment	16	16	25.97	45.62
coral polyp · oil treatment	16	16	25.43	43.81
coral polyp · dispersant treatment	16	16	33.13	67.19
Polyp	10	10	11.60	28.56

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.44
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.22
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.50
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.86
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.57
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.45
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.07
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.84
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.52
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.13
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.44
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.76
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.67
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.27
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.46
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.47
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.04
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.58
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.21
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.10
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.56
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.30
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.10
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.77
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.09
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.16
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.96
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.82
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.18
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.62
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.65
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.40
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.91
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.55
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.65
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.07
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.91
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.94
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.19
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.81
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.53
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.79
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.29
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.09
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.56
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.40
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.18
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.88
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.47
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.87
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.15
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.24
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.46
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.50
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.15
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.78
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.07
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.53
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.09
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.21
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.59
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.22
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.65
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.17
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.75
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.81
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.75
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	28.56
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.16
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.12
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.81
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.26
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.94
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.08
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.04

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.