Gene detail

Detailed information of OS493_029462-T1 in Lophelia pertusa

Genomic Location: scaffold_179:696997...709234
NR annotation: KAJ7354902.1, hypothetical protein OS493_029462 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029462-T1

ATGGAAGCGAATGTAAACAAACTATTTCCAGAGTTGCAGAACTGTTCAGGAGCAAGCAACGCTGAAAAGCGACCCACGAAATCGCGCTCTCGAGTCTGGGAAAAAGTTGTCTGGTTTACAAGAAAGGCGAAAGGAGGAAAAGACAGCAAAACAAGCTCTCCAGAGTTGCATAAGGGCAATATTGGTCGTGCTGCTGGTGACAGCAAAACACTTGATTGCAAGCCAAAAGTACGCAAGACCAGAAGTTTCAAATATCTGAAGCGACGAAAAGTGAGGCAGTTTGGAGGCGACCTGAGCTCAGTAGCGGTCGAAGAAGAAGTTAATGTCCAAGATTGCGGTACAGCAACGGGAACATTTCATGATTTTCAGTCCGAGCGACGAATATCACGCCAAGAAAAAACCGCAAGTAATAACAGCCTGCTAACTGAGATGGCGAAGGGAATGAAACCAGCACAACAAGAGGTGATAAAGGAGAACGTTAAAAGCGTCTTATCTCTACCGATCAACGACTTGTCGTTGAACGAAGGACCAACTTCCGAGAGCTTATCTCCAAGTTTTCCTCGAGTTAGACGAAGTGTGAGTTTCTCCGGGCCAGCCTACAACAGTTGGCCAAGGAAAAAGCGAATATATTTAGAAAATTCCTCGCGTGGTGAACTACTTCTGTCTCCACCATCGAAGCAAAAGTGCGTGACTGGGACGATCAGAAAAAGAGCATCTTTTAGCGGATTCGATTCTTCAAAAATAAATTTGAAGAATTCTTATTTGTCTCTATATAAAGGGGTTAAAAGCACCCCTCATTTACCTCAAGGAGGGAACATCCAAAATCAGAATGGACTAACTATTGGCGCTATACATTTCTATAAAAGCCCAGCTATTTATCAAAAGGATGAGACAACCCTTAAACTTTTACAGAGAAAGAGACAACCAAAACCAACCGATGACGAGTCTTGTGTCGCCAACGCAGGCCTCCTTGGGTCATCTTGTGGGTCTAACTTGGAAAAGGATGGAACGTTATCTCCTTTGTTACCAAGAGAATCAGATGCGATTACTTGTAATGGAATTCCAGAAACAACCGAAAAACTTAACGCAAATGCTAATTCTAACAGTAGTTTAAATAAAGACAGTTGTCAACGTGGCTTGACTTGCACTGAACAGACCGACAACATCAATGTTAGCGACGGTCCAGATAACTGTCTTTCTTTCCACGTCAAAAACATTGACGTGCAAAACTCTACAATCTCAGCTTTTCTGTTGGAGGGAGAGAGTTCTAGTAGCTGCATAACAAATAGTCCAGTAGACTCTCCTGATGAGGACTTAGTCAAGGAGAAGCCATTACTATCATGTAATTCAACTGAAAAAGTGATGCATGTCAGTTCTACAAATGAAAACGTCATCGCAAGAGATAATAATTTTAGTTACACCATGTTAGAGTCAAAGACGCCTATGCATGAAGATGGATCCACGAGGAGTCACAGTAGTGGGTCCGATGAAGCTATGGATATTCCTGAGTGTTACACGTACGCCAATCACACATCACAATCTTCCGCTATTCATCAGGACAAATCGCTCCCTGCAACCGTTTCTGAAGTAATATCAGCTGATAACGAAATCGACAATGCCGTTTTTAGTGCAACACAGTGTAACACACAACATGCCGCAGCACCTTCTTGTAGACTGCCTTCTGTTGACGAAGTTGGCACCTATGGCAACCTACAAACTTTACGGACAAGAAATGAATTGGTGTGGCAGAGAAAGCCGACCGTCAGTGGACCACAGTTTAAAAACCACACCGAGGATATTTTGCAGTGGTTTAGGGAATTTAATGATGAACAGAAGAACATTTTAATCAGAAGACTTCTGGAAGAATGTGAGCTTCCTCAGATGCATATGTTGTCTGTTGCAATGGAGCCTGTACTGCACAAAAGCTGCCCACCAAACTGCCAAGACATGTTGTCCTGGCTGCCGCACCATGTTGCATTGCATGTTTTGTCCTTTCTGGATTCAGTGAGTTTGTGTCACTGTAGTCAAGTTAATCACACATGGAACAACTTAGCTAGTAGTCCATCACTGTGGCAGAATCTATGTGGACGTCCTGACTGGCAGTTGTCTAGGATCGGAGAGGAGAAGGAAAAGAAGAAGTACACTTTGGAAGATGGAACAGTACAGTGGAAGAAGATGTTTGCGTCAAGGTTCCTTTTGCATCAGAACTGGTTAAAAGGAAAATGTGATGTGCGCACATTTGAAGGCCACACCCAAGGCATCTCATGTGTTCAGTTTGACGACACCAGGATCGCAAGCGGCTCATATGACAAGACAATAAGAGTTTGGGATATTCAGAGTGGTGACTGTGATGCCGTGCTGACTCTAGCTGGCCACTCTGGGACAGTCCGTTGTCTGAATCTGAATGGTAACAGACTGGTTAGTGGTTCTGTGGATCGATCCATCAAGGTGTGGGATTTATCATTCAAGTCGTACTGGAGTGGTGCTTCATGTAAGGTGACCATGGTTGGTCATATGCACACAGTTCGATGTCTCCAGGTTGACGACAAGAAGGTGGTCAGTGGATCTTACGATAAAACACTCAAAGTCTGGGACATCAAGACTGGGAATTGCCAGCTAACTCTCAGGGGCCATAATGCTGCTGTCCTGTGTGTTCAGTTTGATGATAGAAAAATTGTCTCAGGATCATATGACAAGACTATTAAGGTGTGGAGCCTGACAGAGGGATCATGTCTAATGACGCTGACAGGGCATCATGATGCTGTTACCTGTTTAAATTTAACCTTTGACAGCAGAAAGGTCATCAGCGGCTCGCTGGATCATAATCTCAAATTTTGGGATCTGTTAAATGGAAAGTGCATTGGTACATTAGACTGGATTAGATCTGAGGGTCACACTGGAGTCATCAGATGCCTTCAGACAGACAGCTGGAGAATAGTGAGTGCTGGAGATGACAAGACACTCAAGATGTGGAGCTTAGAAAGTGGACAGCGTCTGCTGACTCTACGCTGTCACACAGATGGCGTGACATGTCTACAGTTCAATGACTACAGCATCGTGTCAGGATCTTATGACAAAACTGTCAAGTTATGGGACTTTACTCCTTTGCATGAATTTTTGACTCCTGGCTAA

Transcript

OS493_029462-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
D4AM37	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371) OX=663331 GN=sconB PE=3 SV=1
D4D8P3	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Trichophyton verrucosum (strain HKI 0517) OX=663202 GN=sconB PE=3 SV=1
C5FP68	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Arthroderma otae (strain ATCC MYA-4605 / CBS 113480) OX=554155 GN=sconB PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007818 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12937 all species →	F-box-like	F-box-like	Domain	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR001810 all species →	Domain	F-box domain	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR051075 all species →	Family	SCF complex subunit WD repeat-containing protein	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR036047 all species →	Homologous_superfamily	F-box-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19872 all species →	UBIQUITIN LIGASE SPECIFICITY FACTOR/HREP PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10260	FBXW7, SEL10; F-box and WD-40 domain protein 7	-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029462-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.5Max TPM

6.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.83	13.80
polyp at pH7 6	18	18	7.95	12.09
coral polyp · control treatment	16	16	7.99	18.49
coral polyp · oil and dispersant treatment	16	16	6.53	15.79
coral polyp · oil treatment	16	16	7.27	11.49
coral polyp · dispersant treatment	16	16	5.16	10.19
Polyp	10	10	4.02	6.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.80
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.36
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.78
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.94
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.50
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.09
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.25
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.24
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.34
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.45
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.29
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.60
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.13
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.81
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.74
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.49
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.53
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.34
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.79
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.68
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.43
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.42
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.35
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.66
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.79
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.07
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.79
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.68
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.94
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.66
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.27
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.05
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.86
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.09
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.06
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.88
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.84
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.90
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.12
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.19
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.32
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.88
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.56
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.44
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.80
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.25
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.54
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.57
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.32
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.96
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.03
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.48

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.