Gene detail

Detailed information of OS493_029537-T1 in Lophelia pertusa

Genomic Location: scaffold_181:68022...87483
NR annotation: KAJ7389653.1, Sodium channel and clathrin linker 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029537-T1

ATGAGTTCTAGTTTACGTGATGAAGATTACATCAAATTTCTACAAGATCAAGTTAGGAGGCTAAATGGTGTACTTGAGGAATATCAAAAGAAGTACCTGCCAGTAAAAGAACCAGAGGTGAAGGGTTCAGAGCCACTTCCACCATGGATCACAAACTCCAGCATTCTATCTCCTCTTCTGGCAGAGTACGATAACAACATCCAAACTTCTCAGGAGCAGGTTTTGTTCCTAAAGGAAGAGTTGTCATCCTTGAAGCAAAAGACAGACCATGTTGTACAGGAAAACACAAGGTTACACGAGGAATTAAGAAGAAGCATCGAGGCACAAATGGAAATAGTGCGGCAAGGTGAAGGGAGTGGTGTTGAGAAGGAAGTGATGGAAAACATGCGACACCAGCTTCAGCTACTTTCTCAGGAAAGAGACAGTTATGTGGAACTGTGGCAAAATGCTTGCAGTGAGCTTGAAAAGATTCAGGAAATTGAAAGGGAAAAAGATGGAGACCTTAAAGCTACATCAAGGGGCATGGCAAGCTTGCAGAATGACCTTCATAAAGCCAGACAATTTGCCGAGGAACTTCAATCAGTAAACAGGAAGCTGAGAATGGAACATGAAAAATTTCTCACAACAGCTCAGACACAAGATCAAGAAATCGACGAGGTCCGCAGTGATTTTGAGGAAAACATCAGAAGTAAGTTTTACACTGAAAGGTTTAACATACTCTTGTTTCTTTTCTGTGGCAGGAGATGCAAAACTGAGTTAAAAAGCTCCAAAGCGCAGAACGAAGAACTTCGAAGAACGCTGGAGATAATGGAAGGACAAATTAGAGCAAGGGACAGAGAGAGAGGAGATGGAATCAACAAAGAACAATCTGTGGACGATACTCGGGTTGAACAACAACAAACCGCCCTCCTTCAACTCGAGTCAAGGCTTGCCGCAACACTCAAAGAAGTTGGACGCCTCCGATCAGACAAAACGGAGTTAGAAGAAAGATTGGAAGTTTTACAGAAAAGAAGTTGTGAACAGGAGCAGCGTGAATTTGAAGCCATCTCCCATGTTAGAGACAGTGTTCAAATGGTGGAAAATGCGATTCTGGAGAGAGACCAGGCCCTTGTACGCGAACAACAGAAAACTCAAGAAGTGAGCCGACTGCAGGAAGTCATCAATAGAATACTGAGAGAGGCTGGTAAAAGAACAAGAGAAGAGGTGGATTCTGTTCGGAATCAATGCAACAAAAATATCCAGAAACTAATGGAGGAGATGCATTTCTTGGAAATGGAAGGAGCAGAAAAACAGGCTCAGTTGGAAAGATCACTGAGGGAAAAGTCTGCTGTGGAAAAGGAACTTGAAAAGCTGTATCAAGAGGGACCGTCTGAGATTGCGCGGACTGGTATGACTTTTGATGAGCTACAGAAACGAACCGGTCAGGCCGAAAGAACCCGGGACGAGGCCTTACGGAGAGTCGACAGCCTCAATTCCACGCTCAAGAAAATGGAAACCAAGCATGAACAAGACAGGTGCCAGGGTGCCTCAGAGAGTGGCGAACTGAGAAGAAGAATAAAACAACTTGAAGAGGAAAATGAAGAAATGTCAGACAACAGACTTGAGCTAATAGATGAAATAGACAAGCGAAAACGCGAACTTCTCTCCTCTAAACAAGCCAAGGAAGCCGCAGAACACCAGTGCATTACAGAGGTAGCATCGCTCAAGCAACAGCATGAGTTACGTGAAAGGGAGTTTGAATCACGGCTACGGAACGTGGAGGAGATGAACAGGCAATCAGTGAACGAACTCAGAGAAATGTTGAATGGACAACAGAAACTCGGGTCCCAGTGGAAAGAGGAATCAAAAGCCGTAACTCACAAGTTTGAGCAGACAGTAAATGAGTTAAGACAAGAAATCAACAAACAGAAAAGAAGGAATGATGAGCTGAACAGTCAGGTGAACGAAGAACGACAGAAACGTGAACAGCTGGAGTCCAAACTCTCCTCGACAAAACTATCCCAAGAGAAACTTCAGAGTATGGTGGTAGACTCTGAAACGAGGGCAGATGCAGCGAGCTCTCAGGTAACGACGCTTCTTAATCGCGAAAGACAACTATTACAAGAAAGAAAACTCCTAAACCGAGAATTCGAGAAACTAAAGTTAGAAAAGAGTCGTCCTGCCGGCTCCAACAGAATTTGGGAACCTCCCCAACGACTGTCAGACCTGCTGAACACGGCCAACACGGGCGCGTCTATTCATGAGCCCGCGGTTCGTTTGGATCTGATGTCTCCGAGAGATGACGGCGGTTACTCACGAGAGCTTGACGGCATTGGTTCAAGAATGATTCAGTTCAACGGGATTTCAAGAGACAGAGTCATACTTTAA

Transcript

OS493_029537-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96NL6	Sodium channel and clathrin linker 1 OS=Homo sapiens OX=9606 GN=SCLT1 PE=1 SV=2
G5E861	Sodium channel and clathrin linker 1 OS=Mus musculus OX=10090 GN=Sclt1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003174 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15964 all species →	CCCAP	Centrosomal colon cancer autoantigen protein family	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031887 all species →	Family	Serologically defined colon cancer antigen 8	Interproscan
IPR038911 all species →	Family	Sodium channel and clathrin linker 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR35970 all species →	SODIUM CHANNEL AND CLATHRIN LINKER 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005813 all species →	Cellular Component	centrosome	Interproscan
GO:0007098 all species →	Biological Process	centrosome cycle	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0045162 all species →	Biological Process	clustering of voltage-gated sodium channels	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029537-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029537-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

129.6Max TPM

25.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	28.36	48.15
polyp at pH7 6	18	18	39.46	129.58
coral polyp · control treatment	16	16	18.85	79.52
coral polyp · oil and dispersant treatment	16	16	19.92	76.83
coral polyp · oil treatment	16	16	20.41	36.47
coral polyp · dispersant treatment	16	16	15.49	46.33
Polyp	10	10	35.28	50.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.74
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.94
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.99
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.99
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.65
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.42
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.23
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.50
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	129.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	110.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.89
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.44
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.29
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.47
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.06
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.60
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.15
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.83
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.93
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.75
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.72
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.73
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.21
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.82
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.70
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.76
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.08
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.83
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.91
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.26
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.18
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.16
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.94
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.96
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.53
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.81
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.93
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.45
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.47
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.91
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.75
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.14
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.15
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.93
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.29
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.85
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.56
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.36
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.34
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.11
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.43
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.23
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.27
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.72
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.18
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.86
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.83
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.12
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.44
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.67
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.01
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	50.19
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	49.21
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	43.47
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	37.34
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	37.11
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	34.64
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.16
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	28.68
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	25.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.54

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.