Gene detail

Detailed information of OS493_029544-T1 in Lophelia pertusa

Genomic Location: scaffold_181:156639...172713
NR annotation: KAJ7389660.1, hypothetical protein OS493_029544 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029544-T1

ATGGCGGACTTGATCAACTTTGTTTCCAAGAGAGAAATTGACGCTAAAAAGGAAGAGACAAAGAAAGCAAGGGAACAGATACTCAAAAAGGCAAGTGTGATCAATGCGAAAGAAGACTATGAGCGAGAGCAGCGAAGAAAAGAACGACGCATCGAAAGTGGAGAAAGTTCTTGGATGTTGCCTTCCCTCAGTGAGAGGCTGACAGTAGAGGATGACGACAAGGACAAGCACAAGAAGAAGAAGAAGGATGTTACAGGGGAGCATTTCTCATCAGAATCAGAGTCAGATGATGATTGGGTTGAAAAAGGAACTTGTTCACCTCCAGCAACTGATGGAGTGAAATCCTCATCAAAGCCCAGTCAACTTCAGCAGCAGCAGCAGCAGCGCGATAGCTGGATGCTGCGTCCACCAATCACATCAAGCTCTCATGAACCAATGGCTGTAGAGGAAGAACAAGACCAGGAGGAGAGCAAAGAGGAAAATGACAAATCACTGTCCTGTATGGATCGGCCGGGACAGCATGCTAAAGAGCTAAATCCATACTGGAGAGATGGAGGCACTGGGCTACCATCACAGACAGACAGGTCACAGGAAACCACTCATATGGAAGAAAGTTCCAGAAGTTCATTTAGCAGTGCTTGGTTAAAGAAAGCTTATCAGAGAGCTAAGGATCAAGCTGAGGAGGAAAGGAAGAGTTTGGCTGAAGTTGTTTCCATAAGATATGGGTCTGTGGAGAGACTGGAATCGATGATCCAGGAAGCAGAGGAAAGGGAAGCAAAGCTGAGAAGGGATGAATCAAAGCCGACAGGGAGAGAGAAGTACAGAGGCGACAAGGACAGCAGGGATGATAGAAGACAAGATAGAGACGAGAGAAGACACAGAGAGAGGAGCCCGGTCAGACATGACAGGCACAAAGCAGGTACATACAGGGCTGCTAGAGATACTGAGGAAGAGAAATGGAGAAGAAGACCAGAAAGAGACGATGAAGGAAGAGAACGACTGAAAAATGATCAACAAGATTTGTACGTCCTACCGACAGTGATAACAGGTTTGTTTATGTTCTGTTTCCAAACGTCATCAAGGTCGTCGTTTGCTGGTAAGTTCAAGCGTCCGCCGACATCAACACCAGTATCTGTGAGTACATCTACATGGAACTTTGACTCAAAAGAAGAGTCCAGGAGCAGAGAGAGACATGGAGAAGAAAGACCAAGCTCCAGGCCCTCTAACGGATGGAGAAAGAAGCAAGAGACTGGGACTGACAAAGGGTCGTCATCTCATGAAGTACAACAAACTGAAGACACAGCTCAGGAGATGAAGTCAGAATCAGAGAGAGACAGCAGTTCAAGCTCCGATGAGGAAGCTGACGAGAAGAGAACTGTTGTGATTCCTGCAAAGAAAGTTACAGAAAAAGATCTCAATGACACCGGAGCAAAGATTGTGAAGGCAGAAATCATGGGAAATGAGGATTTAGCAATCAAGTTGAAGTCACAACTGGAAGAGATGAGAAAAAACAAGAAGCTACAGGAAGCTGTAGTGAAGGAGAGTGGCACAACAGATAAACAGACTGAGGAGATGGTGATATTAACACGGACTGATGCAGCTGGGAATGTTTGGCCGCTAGAAATGACAGAGCGGCAGGAACCCACGAGAGGACGAAAGAAACGAAAAAAGGTGGAGACGCATGGTAAAGAAGGTACAAGGGAGAGGTACTTTGCAGATGATGACAGATATGATCTGAAGGAAATGGTGAGAAGAGAGAAGATGTGTACTGTGGGGGACAATGCTGCAATGATGAGCAAGCTTGCTTCTAAGGCGACAAAGAATGCTTACTCAGATGACTTCATGTTAGACGATCATTTTGTGTCATCCGCTGCTAATGAAATCTCTTCAGCTCAGATGGAACAACGAGAAAAGCAGAAAGCAGTTCAAGCCCACAGACTGTTGGCTGCTCAACTGGCAAAATGCCGCTTCTGTTTTGAGAACCCGGACATTGCCAAACATCTCATCATTGCTATCGGCCTCAAGGTGTATCTGGCGGTCCCACTGCACGAGTCTCTTACGGATGGTCATTGTCTCATTATTCCAATGCAACACTGTTCCGCCTCAACTCTCCTGGATGAGGACGTGTGGAGTGAAGTACAGATTTACAAAAAAGGTCTTACCAAGATGTTCGAAGAAATGGAAGAGGACGTGGTTTTCCTGGAGACATTCAAACAGTTGCAGAAACAACATCACATGATTATTGAATGTGTTCCACTTCCCAAAGAGATAGGAGAAATGTCTCCTGTTTATTTCAAGAAAGCTATTTTGGAATCCGACACAGAATGGGCACAAAACAAGAAGCTGATAGATACAAGACAGAAAGGACTGCGAGCAGCTGTTCCCAAGGGACTTCCTTACTTTAGCGTCGAGTTCGGATTGGACGGCGGATTTGCGCACGTGATTGAGGATGAACAACTGTTTCCGCATTACTTTGGTAAAGAAATTGTTGGAGGAATGCTTGACCTTGAACCGCGCAGATGGAGAAAGCCGCGACGGGAAAACTTTGAAGAACACAAGAGAAAAGTGTTGCGGTTTGCGGATTGGTGGAAGCCGTACGACTGGACTCAGAGGATAGAGAGGAACTAA

Transcript

OS493_029544-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q2TBE0	CWF19-like protein 2 OS=Homo sapiens OX=9606 GN=CWF19L2 PE=1 SV=4
Q3LSS0	CWF19-like protein 2 OS=Danio rerio OX=7955 GN=cwf19l2 PE=2 SV=1
Q28C44	CWF19-like protein 2 OS=Xenopus tropicalis OX=8364 GN=cwf19l2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004020 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04677 all species →	CwfJ_C_1	Protein similar to CwfJ C-terminus 1	Family	Interproscan
PF04676 all species →	CwfJ_C_2	Protein similar to CwfJ C-terminus 2	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040194 all species →	Family	Cwf19-like protein	Interproscan
IPR036265 all species →	Homologous_superfamily	HIT-like superfamily	Interproscan
IPR006768 all species →	Domain	Cwf19-like, C-terminal domain-1	Interproscan
IPR006767 all species →	Domain	Cwf19-like protein, C-terminal domain-2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12072 all species →	CWF19, CELL CYCLE CONTROL PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000398 all species →	Biological Process	mRNA splicing, via spliceosome	Interproscan
GO:0071014 all species →	Cellular Component	post-mRNA release spliceosomal complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24940	CWF19L2; CWF19-like protein 2	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029544-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

29.3Max TPM

12.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.67	21.99
polyp at pH7 6	18	18	16.20	29.28
coral polyp · control treatment	16	16	13.02	19.97
coral polyp · oil and dispersant treatment	16	16	8.71	21.02
coral polyp · oil treatment	16	16	13.15	16.21
coral polyp · dispersant treatment	16	16	7.05	13.41
Polyp	10	10	13.07	19.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.99
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.28
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.04
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.14
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.31
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.12
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.84
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.20
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.38
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.79
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.56
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.61
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.87
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.56
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.15
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.92
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.82
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.42
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.86
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.49
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.40
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.28
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.86
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.79
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.08
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.98
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.62
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.81
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.61
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.78
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.36
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.54
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.57
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.02
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.92
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.10
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.46
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.35
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.21
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.79
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.63
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.84
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.94
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.21
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.72
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.57
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.52
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.83
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.64
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.59
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.20
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.57
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.81
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.41
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.52
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.08
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.91
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.90
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.76
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.62
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.51
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.24
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	17.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.34
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.04
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.54
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.44
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.62

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.