Gene detail

Detailed information of OS493_029546-T1 in Lophelia pertusa

Genomic Location: scaffold_181:179403...187201
NR annotation: KAJ7389662.1, tudor domain-containing protein 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029546-T1

ATGGAGGCAAAGTTGAAAGAGAACGGATGGTTTCTCTCCACCGAAGGGATTGCAGAGTGTGAAAGGGCTTGCAACAAAGAGAAGCCATCTTTGCAGGAGCTCTCGAAGGCAGCCCTTAATCTGGACTTAAGGCAGTATGGCATGAAGCATCTTCCTGATGATATCAGCAGAGGCAAAGTGCAAACAGTCAGTGGACCCATGGTTCTTCAGGTGCAAAAGTTACGTAATATCTCTGCTCCAAAAGCTAATGAAGAGTCAAACCATGCACCAAGACTGCTGAAGATACAGTTGACAGATGGACACCTGACATGTCATGGCTTAGAAAGTGCATCTATTCCAGAGCTCAGCTTGTCAGTACCGCCAGGGAGCAAGGTTTATTTAACTGGCACCATAACTGTTCAGGAAAGCTTTCTGATGCTGGACTCTAACAATACAAGAGTTTTAGGAGGAGAAGTGGAGAAACTGAAGGAAAAGTGGGAGCTTAATAAGACCTTAGCCAAGCATTCTCGTTTGACTGTGAGTGGAGATGGACCTCCTCCATTTGTTCCTTTTGGTCAAGGAATGCAGCCAGGAAGTGAGAATAAAGGAAGAACAGCAGAGAACCCTAAAGTGAATGGTGTAGTGCAAAACAGCGTAGAAAAACCTAAAAGTTCTCAGAGCAGAGAAGCAAATGGTCCGCCATTGAAATCCAGAACATCTGATAATGGACGAAGCAACAGACCTACCAATCAAGAACAGAGAGATGGCAGTACAGTTAAGAAATTTCCAAACCACGGAACAAGGGACGACAGAACAGAAAGCAAGAGGATGAATACTGAGAAAACAAACAACAGATACACAGCTGAGGGGAGAACAAATGTGCAGAATAATCCAAGAGAAAAAGAGACTAGACCATTTAATTCAGAATCACTGAATCATGACAGACCAAGACATGGAAACCAAGCTGACGATGATAGGCAAAACAGCAGAACAGATCGAAGTGAGAGGACGGAAAGATCATCAGCAAGAGGACAACCTTTGAGGACTCAGGATACAAACAGAGGAGGTGCAAGGCCACGAGGTCGTGGAGGAAGACGTGAACCAGCTGGGAGAGGAAGGCCTGAAAGTGACAGCATTGATGATATGGAAGACTACAGAGTTAGACAACCCTCGGAGCCAGCTTTATGGGACTTTCTTTCAACAAAATTTCCATCAGTTAAAGATACAAAACATCAAAGACCACAAAAGTTTACAGAAAACCAGAAAACTGACGAAGCACAGCATGAAAGACCTCCTCCTAGACCACCGCCCAAACAGGAAAGTGACATTCAAAAGCCAAAGCAACATAAGCAGGATTCCAAAGTTGAGAAAACTGAGAACATTCCTCCCCAAGACAACAGCAAGGCGACGCACAGGGAGAGTATGCCACTGCAAGAGATGTTGAGAGACCAAAACAGGAAACGTCACATCAACATAGAGATGCAGAACCCTGGGCAGGCAAAGGGGAAAGGTTCTAGAAGGCATGATCATGATTCTAGACCATATAATCAAAGTTTACCACCAAGGCTACAGAAGAAACAACAACAGCAGCAACAGCAACGGCAGCAACAACAGCAACAACAGCATCATCATCAGCACTATCAACAACACAGTCCACAGCAAGAGACGGAGGTGACCAGTGACGAGGTTGAAGCTGAGTATTCCAGCGCAGCAAGCCCACCATCTGTAGCTCAGGAAGACAATGCCATTGTAAGGTTTAGTGCTGTTCCAGTCAGCCATGAATATGCCGAGGAATCTCCGAGCCAGATTCTACAGCCAGTGCAGTTTCAGGAGCTCCAGGCTAGCTCATATACTGGTCAGCAGTATCCTGGTCAGGCAAAGTGGCAGAAAAATTACCGCCAAGGATCTGAACAGTTCAGGCCTCCAGGTTTTACTCCTCCTAATGTACAGCAACAGCAACAGCAGCATCTAGAGTTTGTTACCATGGCAATGGAGTCCCAGCGCTCGCAGACACAATTTATTGTCAGTCAACCTCAACAGTTTGTGGAACAGGGTGGGAGAGAGCAGCCACAGGAATACCAATATACACAGCAGGCCCAACCCCCAGTACAGGCGTACCCTGTGTACCAACTCCGCCCTGCTCAGATAGCACAACAGCCAATGGCACCTCACCAACCATACCGCAGCAGCCAGTTGCCACACAGATGTCAGCAACACAGGTGGGATGGAAGAAGGGTGATCACTGCTTGGCTCCTTGGAGAGATGGACAGTGCCAAGATGGAGGAGCTAGTGACTGACGGTGTCAATTGTGTGGTTTCTTTCTTGGATTTTCATAATTGCTGTGATATTGTGCCTCTTGCTTCTTTGAGGCCTTTTCCAATTATTGCCTGGGGAGAGAGTGGTAATGCACAGCCTCAACCTGCTGGTGCTGTTGCCACGGTACCTTATTATACACAGCCAGCACCTGTCAATATGGTGTCCAGACCCCAGGTTGTCATCCCGGTGACTGGGCAGCCTGCTTTCCATGCTGGTACCAGGCCTACTATTGTTCATTCATCACCAGTCCCTACACAAGTTCACTGGCAGCCAGCTCAGGTCCAGTACCAGGAAGTAAGACCAGCAGCATTCCAGCCTGTAGTGCACTATGGGGCTGTGCCACAAACATCCTCAGGAGGCCCTGGTCAGGCAGCCTATGGAGTGACCACTGGGGTACATTTTGTCAGGGGAGTGAAAGATCCTCAAGTACAAGGTACCAACGATATCATGTGTTTGATCGAGTTTAATTCAGCATTCCTCACTGATAATAGGGACCGTCAGATTGAGATGTTTACAGTGGCAGCCCAGATGGAGCAAGAGGAAGATCAAGTCCAAATTCAAGTGGTTACAACAAGCAAAGAAGACCAAACAGAACAACACAGAATTATTATGTGCCACCCAGACAACAGAAATTTAAAGATAAAGGCTAGACATTATTAA

Transcript

OS493_029546-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZMS6	Tudor domain-containing protein 3 OS=Gallus gallus OX=9031 GN=TDRD3 PE=2 SV=1
Q6NYG6	Tudor domain-containing protein 3 OS=Danio rerio OX=7955 GN=tdrd3 PE=2 SV=1
Q91W18	Tudor domain-containing protein 3 OS=Mus musculus OX=10090 GN=Tdrd3 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006000 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08585 all species →	RMI1_N_C	RMI1, N-terminal OB-fold domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042470 all species →	Homologous_superfamily	RecQ mediated genome instability protein, N-terminal OB-fold domain superfamily	Interproscan
IPR013894 all species →	Domain	RecQ mediated genome instability protein 1, OB-fold domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13681 all species →	SURVIVAL OF MOTOR NEURON-RELATED-SPLICING FACTOR 30-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029546-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029546-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

22.2Max TPM

9.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.32	13.31
polyp at pH7 6	18	18	9.29	11.35
coral polyp · control treatment	16	16	12.86	22.20
coral polyp · oil and dispersant treatment	16	16	10.72	13.89
coral polyp · oil treatment	16	16	10.90	15.96
coral polyp · dispersant treatment	16	16	8.18	14.83
Polyp	10	10	4.44	7.11

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.31
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.82
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.66
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.32
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.45
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.40
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.56
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.94
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.93
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.75
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.34
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.74
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.12
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.88
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.06
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.20
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.33
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.64
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.88
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.36
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.91
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.68
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.94
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.88
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.32
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.58
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.96
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.16
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.51
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.63
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.73
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.86
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.09
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.34
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.57
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.23
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.96
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.63
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.62
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.09
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.91
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.62
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.06
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.62
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.52
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.73
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.60
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.60
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.88
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.87
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.81
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.06
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.99
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.11
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.87
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.43
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.33
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.02
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.21
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.11

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.