Gene detail

Detailed information of OS493_029689-T1 in Lophelia pertusa

Genomic Location: scaffold_183:148027...162909
NR annotation: KAJ7377330.1, Calcium-dependent secretion activator 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029689-T1

ATGAGCTTCTGGCAAGGCAATTCCCAACCAGATCTGTCAGTCACTGGCACATCCACCTCGCGTCATCAGAGGCCACCAAGTGGCCAACGTGTGCGGCCGAGCAGCGCTGGAAGGGGAGGAAGTACTAAATCTCATATATTTGGTACTACTGATACCCCCAGACAAGATGACCCCAAACAAAAAGCCGGAAATAATTTCCATGAGAACAGTGCTGCATCAAGCTCCATCCACACTACTCCGGAGGCACCACGCCCATTAAGTGGGCACCCACCTACAAAGGCTTCAGTGATCACAAAGTCTCAGTTGGATGGTGCCAGAAGTTTAGCCAAGGCAAATCCAAATTATGCTGACCAACCAGTTGAAGTGCAAGTTTTCTCAAGGAGTCAGATGGGTGGAAGAAAGCTGGCACCTCAAGGAGTACCACAGTTAGACTTGGGATACCTTGCAGATGACAATAACCAGTTGCTACAGCCAGCAAATGTCGACGGTCCTCATTTGCACACACCAGACTCTAACAACAGCCTTATCAGCTGGGGAACTCCTCTTCACAGCTCAAGATTTCATCCCAGTCCTGCAAAACCTAAAGGAGGTGGTTGGCAAGTTCAACAGGCTCGTGCTGCCCAGTCCCATAAAAAGCCAGCTGACATGCCCCCTCTTGATCTAAACAAGTCACATGGAGATTGTGGCCTGAAGCAGGCTCTTCAGGCAGGAAAAGAGGTTGATAGGGACATAAACCATGGGGTCCAATTTGAAGAGAAGCCATTCAAGGCAGATAGTCATGATCCTTCTGAGAATGCAAACAAGTACAGCACGGCCAACCAGTATGACAGACCATGGAGTACACAACCACACACTCAGCGAGAGATGGCTCAGTTGAAAACAAGACAAGAACAGGAAATATTGCATTCAGAGAAGAAGAAGGATCTGATTGTAGAGACAGTTCTAGTTGATCAGCTGTCCAGGGCAGCCGTTTCTGATCCAGAAAAAAACAGCAGCACTATTCCTCCAGATCTGGGACCCAAGCAACGAAAGCAAATGGAATTTTATAACACAAGGAGTCCTTCCAAAGGTCCAAACACAGAGAATGTTCTTTCCAAGAGAGTGCGTTTTGGAGCCAGAATTGTGACGAAGAATGGCCGTGATGCACATAGAGAATTAAATGGCTTCTTCTTTTCAGCGGACAACACACTGACACTTTACGAATTTCACCAGTTTGGAACAAGATCATCAGCTCTTCCCTTCATTCAGCGTGGCTGTTATAGCCACGTTCAAGGGAAAAAAAGAGGACAAGCTTTCACCCTGTTAGACATCTGTGTGGGAAGTAATTTATCATTTATGACAGCTCCACAAACATCTCTTCCCCAGAGCATAAGAACGCGCCCTGTTGTAGTGTTTAGGGTTTCTGAAGTTGATCAACAAGCCAGAGAGATGCAACTGTTTGAAAGCTGCCATTCTCTTGATGACAAACGCTCAGTAATGGAGAGAATGGATAATCCACACTCAGAAGCAGAATTGCAGGAGAAAGAACTCTTGGAGAATGTACAAAGTGTGGTCAAGCAACAACTTCAAAAGAGAGCTGTCAAGACAATGATGGGTCTTGGTCAACACTTTAGAAAAATGGACAGATCAGGAGATGGACTACTAGATAGACATGAACTCCAAAAAGCTCTGGAGTCTTATCACATTAGAATACCAGATGAGGCTTTTGACCATTTGTGGAATGTGTTGGATGTAAATGGAGATGGATTCTTAGACTATGGAGAGTTCTCAAGGGGATTTATTGGTGAAATGAATGAATTAAGGAAGTCATCTGTTAGAAAAGTGTTTCGTAAGTTGGATCCAAATAAAAGTGGTGTTGTTAATTTGAATAACATGAAAAAGTTTTACTGTGCCAAGAAGCACCCTAAAGTTGTGTCAGGAGAGGCTAAAGAATGGGAAATTGAAGAGGCGTTTCTTAGTTCCTTTGAGCTTTGTGAGAACAAAGAACAAGTTACTTATGCAGAATTTGAGGATTATTATGAGGGTGTAAGCCTTGGTTTTGAGAGTGATCAGGAGTTTACTGCCATGATGAGGAACTGTTGGGGTGTATAA

Transcript

OS493_029689-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BUG5	Calcyphosin-2 OS=Mus musculus OX=10090 GN=Caps2 PE=2 SV=2
Q9BXY5	Calcyphosin-2 OS=Homo sapiens OX=9606 GN=CAPS2 PE=1 SV=3
Q9GKR6	Calcyphosin-2 OS=Macaca fascicularis OX=9541 GN=CAPS2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005773 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13499 all species →	EF-hand_7	EF-hand domain pair	Domain	Interproscan
PF13202 all species →	EF-hand_5	EF hand	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR051581 all species →	Family	Calcium-Binding Signaling	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR34524 all species →	CALCYPHOSIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23909	CAPS; calcyphosin	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029689-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

111.4Max TPM

20.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.82	111.41
polyp at pH7 6	18	18	37.41	105.93
coral polyp · control treatment	16	16	15.91	42.72
coral polyp · oil and dispersant treatment	16	16	10.62	26.90
coral polyp · oil treatment	16	16	13.76	20.87
coral polyp · dispersant treatment	16	16	9.55	20.14
Polyp	10	10	22.08	82.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	111.41
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.63
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.84
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.31
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.76
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.51
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.95
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.46
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.07
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.07
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.55
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.29
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.42
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.31
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.13
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	105.93
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	101.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	99.49
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.52
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	69.75
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.04
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.70
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.31
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.56
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.95
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.62
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.35
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.16
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.82
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.72
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.34
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.53
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.56
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.78
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.92
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.69
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.62
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.34
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.63
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.90
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.40
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.29
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.63
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.62
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.36
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.46
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.47
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.87
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.87
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.65
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.44
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.98
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.38
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.96
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.04
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.02
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.99
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.63
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.86
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.06
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.84
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.46
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.99
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.44
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	82.79
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	76.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.95
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.78
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.14
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.90
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.35
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.