Gene detail

Detailed information of OS493_029696-T1 in Lophelia pertusa

Genomic Location: scaffold_183:217950...232749
NR annotation: KAJ7377337.1, hypothetical protein OS493_029696 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029696-T1

ATGGTCATGCAAATAAAGCTTATTGTTGTTGTTGTTGTTGTTGTTAAAACCAACTGCGCTGATTTATCCGCTCCGCCGGATAACTGGATAACAGGTGAACAAATTAAAACAGGAGCCATAATCTCTGATTATGTGATCGATTATGTAAAACCAACCAAGATTTCGTGTTTAACAGTGCATCATTTTGTTCTAGAAATACACAGGCAGTCGAGCCAGCGGATAACCACAGAACAGGCAAGTCAGTTGAAGGCGGAACAAGTGACTTTACACAAAAAAGAAAACAGACAGGCTCACAAAACTGATGAGTACGAGATCGAACTATTGATACTAAGAAGAGGACAGGCGTTTGACGTCACAGTGACGTTTAACAGAGACTACAACCCAGACACTGATGTCATTACGGTGCAATTTGTTACTGGTAAAAACCCTCAGCAAAATAAAGGGGGTATCGTGCGAGTCCAAATCCGAGATGCACTCGTTCTTTCGAAATGGGGAATGCAAGTCAAAGAAGCCAATGGAAACACAGTTCGCCTGTCAATCATGTCATCCGCGCAAGCTGCGATTGGCTATTATGATGTGATGGTGGAGACAAAGTCCAAGGATTCCTCTGGAGAAGAATCTCTGTATCGATACAAACACGAAGAACAGATTTGTATCTTGTTCAATGCATGGTGTTTAGAGTACGTGTTAAAGGAGAAACGGGCACCTTTGGAGGGGCAGCTGGAAAAGAATTTCAAAAATACCCTGGAACTTCGGACAGATGTGGCTTTAAATTGCGCTCTGTGGCTGCTGAGTGAAAAGGCAAACCTCAGTTCTAAGGCGATGTCCAATGTAGTCCATGTGGCTCGTACAATGACATCCATGGTCAACTCGGCAGACATTGGCGGCGTCTTGCAAGGCCGCTGGGAAGAAACATACCCAGAAGGCACTGCTCCCTGGGAATGGAGCGGAAGTATTGCAATTCTGGAAGAATTTTGGAAAACAAAGAAAGTCGTAAAATACGGGCAGTGCTGGGTGTTTTCAGGAGTTCTGACTTCATTGCTGCGAGCATTAGGAATACCGACAAGAAGCGTGACAAACTTCCAGTCTGCGCATGACACAGAGAAAAGTTTAACCATTGATTACTTCTTTGACGCTAATGGGAGACCAACTCAGCCTGACCCTTATTATAAAGATTCAGTCTGGAACTTCCACGTGTGGAACGAGTGTTGGTTCAAACGCCTTGATCTGCCAGATGGTCATGACGGATGGCAAGCTGTTGATGGCACACCACAGGAGTCTAGTGAAGGTGTTTATCAGTGTGGACCGGCCTCTGTGAATGCCATCAGGAATGGTGAAGTGTACCTCAACTACGACACTGACTTCATCTTCTCTGAAGTGAATGCAGACAAAGTTTATTGGGAGGCTCCCTCTGACAGCGGGGAGCTGAGGGTGATTCAAATCGACCACCATTCCGTTGGCAAAAGTATTAGCACTCAAAAGCCTGGGAAGGTAACAGAAAGAAGAGACCTTACACAACACTACAAGCAACCAGAAGGGTCAGAAGAGGAGCGGAGAGTGGTTGAATTTGTGCACAGGTTCAGCACCAGACAAGATCTCCAAATCTACGGACCTGCTGAAAGAGACGTCACTTCCAGACTTGATGTGGTTGATGAAGTCAAACTTGGAGAGCCGTTCAAGGCCACTGCAATTGTAAAGAACGAATCTAACGAAAAAAGAACAGTCACTGGTCATCTTACAGCTATTTTGGTGTTTTACACCGGACGAGCAGCCAGGACTATTAAAGAGGCAGAAGATACTATCATTCTGGAACCAGGCGAAGAAAAAAGTGTGGTGCTAGACATTTCATTCCCTGAATTGCTGGGCAAGTCGATAGCAGACTGCAGTGTCAAAGTATTTCTGAAGGGTTCAGTGCACGAAACAGATCAGCGGTTTGCCGTTCAGGACATTGTCGAGTTTATTATGCCAGAGCTCGAAGTCACGTTTTCTGGAGCCGATAACGTAAAGTTAAATGAAGAGGTTACAGTGACAGTGTCTTTAACAAACCCGTTACCGATGGATCTGACGAACGGGAAATTTCACTTTGAATTCAACCTTATGAAACCAAGGACACTGGTTGTTGATTGCAAAGGCCCAGTGCGTGTTGACGAGAAAAAAGAGGTAACTGTGACCTTCCTTGCGGTAAAGAGAAGTGGATTTCGTAATCTGTCAGTCAACTTCAACTCAGCGGAGGTCACCGGAGTAGTTGGAGAGTCGTACGTACTTGTTTACTAG

Transcript

OS493_029696-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q05187	Hemocyte protein-glutamine gamma-glutamyltransferase OS=Tachypleus tridentatus OX=6853 PE=1 SV=1
P22758	Protein-glutamine gamma-glutamyltransferase K OS=Oryctolagus cuniculus OX=9986 GN=TGM1 PE=2 SV=2
P22735	Protein-glutamine gamma-glutamyltransferase K OS=Homo sapiens OX=9606 GN=TGM1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000881 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00927 all species →	Transglut_C	Transglutaminase family, C-terminal ig like domain	Domain	Interproscan
PF01841 all species →	Transglut_core	Transglutaminase-like superfamily	Family	Interproscan
PF00868 all species →	Transglut_N	Transglutaminase family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036238 all species →	Homologous_superfamily	Transglutaminase, C-terminal domain superfamily	Interproscan
IPR036985 all species →	Homologous_superfamily	Transglutaminase-like superfamily	Interproscan
IPR008958 all species →	Domain	Transglutaminase, C-terminal	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR002931 all species →	Domain	Transglutaminase-like	Interproscan
IPR050779 all species →	Family	Protein-glutamine gamma-glutamyltransferases	Interproscan
IPR001102 all species →	Domain	Transglutaminase, N-terminal	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR023608 all species →	Family	Protein-glutamine gamma-glutamyltransferase, animal	Interproscan
IPR014756 all species →	Homologous_superfamily	Immunoglobulin E-set	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11590 all species →	PROTEIN-GLUTAMINE GAMMA-GLUTAMYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003810 all species →	Molecular Function	protein-glutamine gamma-glutamyltransferase activity	Interproscan
GO:0018149 all species →	Biological Process	peptide cross-linking	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05624	TGM6; transglutaminase 6	EC:2.3.2.13	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029696-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

90TPM > 0

7Conditions

2.9Max TPM

0.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	13	0.74	1.53
polyp at pH7 6	18	10	0.47	1.38
coral polyp · control treatment	16	15	1.32	2.77
coral polyp · oil and dispersant treatment	16	15	0.81	2.47
coral polyp · oil treatment	16	16	1.01	2.32
coral polyp · dispersant treatment	16	14	0.78	1.72
Polyp	10	7	0.77	2.90

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.53
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.32
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.19
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.73
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.51
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.38
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.24
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.15
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.08
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.57
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.33
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.80
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.78
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.61
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.23
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.02
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.84
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.57
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.55
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.54
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.54
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.09
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.07
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.25
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.17
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.09
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.94
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.79
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.75
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.35
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.67
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.65
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.16
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.44
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.44
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.02
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.18
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.