Gene detail

Detailed information of OS493_029779-T1 in Lophelia pertusa

Genomic Location: scaffold_184:361361...376577
NR annotation: KAJ7370789.1, DOMON domain-containing protein frrs1L [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029779-T1

ATGAAATTTAAAGATGAGTTTTGGACGCACGACCAGAATGATATTATGGTCACAGTTATTGTGCTTGTGCAGTTATCAGAACTATGGGCGTTTCCTAACGGTCCTCCGTTGAGCTCGTGCGACTCCATGTTCCCTTATCATACCGATGCCAATAAAGTTCCATACAAACCGCAGACTGGAGAGGCTCCTTACAACATCACTGTGTCCAAAAGTTCGTACATCGCTGGAGAGAATCTTACAGTGACCATCTCAGGATCAACTACTTTTAAAGGATTCATATTACATGCTCGCGGGAGTGACAGCTCAGTTGCGTGGCCAGTAGGAGAATTCGTCCAAATCCCTAATGTCGCGCAATATCTATACTGCTCTGGTGGAGAACCAAAGAACACGGTTGCTCATAACAATCCTAACAGCGATGGTTCTCTCCAGTTCACATGGATGGCTCCCGCAAAGAGTGCTGGGAACATAAGCTTCGTCGCTACCATCGTTCATAAGTACGACACGTATTGGACCAACGTTGCCTCATCTGTAGTTACCGGGCCACCAGCAGAAAACGTCACTAGAGGGGTCACAACTGAGAGCTTTCAGATTGACAAGACCGGATGTGGAAAAACCAAAGGATGTTACTCGCTGCCACCAAAGTGCACCGGAAGTGCGGACTGTTCTTATCTGTTTACTTATAAAGTTGACGGAGGAAATGCTGTGATAGAAATGAGTGCTAAACAACGCTGGGTTGCAGTTGGCTTTAATGAGCAGAAGTTAATGGACAAGATGGACTCCATAATGTGCGTCGCCATGGCAACGAATCTGGCGGAATTACGTCATTACTATTCTCTTGGCCACTCCCTTTTCCGACAAAACCTGGCTGGCAACAGTGACCTCACAATAACGACAATAGTTTACGAGGATGGTGGAATTAAGTGCAGGGTGTCTCGCAAACTTACTTCAAGTGAGGCTCACTTCAGAGATCTGACAAAGAAATGGTATCTTCTTTTTGCGCATGGTGCAGCAAGTCCTTCTGGCAGTGCTCAGTATCATTTTACAAATAGAACTTTCACTGGCGACATGGTGGATCTCTCTGTTCCCGCAACATTAGTTGATGAACAGAGTCAAACCAAAGAGACGATTAGCAAAGATGGATGCGGTAAAACAAAAAGCTGTTATTCTGAGCCCGAGAGCTGTAAGTCCAGCAGGGACTGTGAGTACCTTGTGACCTTGAAACCCGTGGGGGAGAAGGGTGAGTCCGGCGAGGTGGAAATCGAGATCAGCGCAAAGAAGCAGTGGGTGGCCATTGGTTTTAACAAGGAAAAAATGAAAATGCCTGGTACCGATGGCTTAATCTGTGCTGACGTCAGTGGACAGGTTTCTGTAGACCACTTTGTGGTTAAAGGTTACGATAGACCTACCAAGACCACCCCAAGACCTGCCTCCATTGTTAAAGATTTGGGAGAATCAAGAGGTGGAGTTGTAAGTTGCCGTTTTCGAAGAAAATTGAAAGATAAAGATGATAAAATGGTGGACCTAACTGAACCGTGGTATCTTGTGTATGCAAGTGGATACATGAGCGGAGACACAATAGACAAGCACCCTTCTACTCCAAGAACAAGTCCTCAGAAGGTCGAGGTGAATAAAATTGAAGTCCTTGGTGCAGAAAAGGTGGACACCGGAATGATACGAGCCCACGGTTGTTTAATGGTAATCGCTTGGGTTGGTTTCGCGTCGATTGGAATTTTCATGGCTCGTTACATGAAGGTGGCATTTGGTGATAAGGTGCTGCTGGGTACTAAAGTGTGGTTCACGTGCCACCGTTCATTGATGGTTCTGACAGTCCTGGTGACTATTATCGCCATTATCATCATATTTGTTCATGCTGGACGCTGGACCGAGGAGGCTGGTGCCCATCCAATCACTGGTATTATTGTACTGGTGCTAGCTGTTATTCAGCCAATCATGGCATTGTTTAGACCCCACCCCGGAGAGGCTAACCGCTACATCTTCAACTGGGCTCATCGTGGTGCTGGTTTGTCTGCACTAATCCTGGCTGTGGTGACCGTGTTCCTTGGTATTCGCCTTCCTGGCGCAAGCCTGGATGACTCCGCCCTGTACGCCATGATTGCCTACTGTGTGGGCGTGGCTATTGTCATCATGTTTGAAGTTTTCCTTTCTTTGAAGAAGAACAGGAGCGCGGCAACTTTCAGCTCGTCAGGGGGAGATAAAGGGGAAGGCCATGTTCAACTGGAACCCCCTAGAGAACAGTTCGTGTCTGCACGTCAGAAGATGTTGGGCTTCCTAGTGCTTTTTGTAACTGGTGTGGTCATTGCGCTTGTTGTGTTGATAGCGACCGCTGAAGAAGGCCACCAACACTAA

Transcript

OS493_029779-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6INU7	Putative ferric-chelate reductase 1 OS=Xenopus laevis OX=8355 GN=frrs1 PE=2 SV=1
Q6ZNA5	Ferric-chelate reductase 1 OS=Homo sapiens OX=9606 GN=FRRS1 PE=1 SV=2
Q8K385	Ferric-chelate reductase 1 OS=Mus musculus OX=10090 GN=FRRS1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000664 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02014 all species →	Reeler	Reeler domain	Family	Interproscan
PF03188 all species →	Cytochrom_B561	Eukaryotic cytochrome b561	Family	Interproscan
PF03351 all species →	DOMON	DOMON domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006593 all species →	Domain	Cytochrome b561/ferric reductase transmembrane	Interproscan
IPR005018 all species →	Domain	DOMON domain	Interproscan
IPR002861 all species →	Domain	Reeler domain	Interproscan
IPR042307 all species →	Homologous_superfamily	Reeler domain superfamily	Interproscan
IPR051237 all species →	Family	Ferric-chelate Reductase and Defense	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45828 all species →	CYTOCHROME B561/FERRIC REDUCTASE TRANSMEMBRANE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016021 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029779-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029779-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

11.5Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.22	8.03
polyp at pH7 6	18	17	4.50	8.35
coral polyp · control treatment	16	16	5.45	11.46
coral polyp · oil and dispersant treatment	16	15	4.57	7.46
coral polyp · oil treatment	16	16	4.94	9.92
coral polyp · dispersant treatment	16	15	4.72	10.06
Polyp	10	8	0.99	2.51

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.03
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.84
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.12
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.67
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.46
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.64
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.61
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.14
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.09
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.04
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.78
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.35
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.28
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.10
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.46
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.30
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.86
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.31
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.31
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.16
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.03
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.15
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.29
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.07
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.05
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.85
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.20
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.70
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.25
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.25
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.09
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.06
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.83
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.92
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.07
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.77
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.83
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.88
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.38
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.06
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.75
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.18
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.34
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.55
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.32
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.26
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.94
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.24
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.91
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.63
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.24
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.