Gene detail

Detailed information of OS493_029825-T1 in Lophelia pertusa

Genomic Location: scaffold_185:197656...200378
NR annotation: KAJ7354819.1, DIS3-like exonuclease 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029825-T1

ATGGATTTGAACGCTAAAGAACCGAATGCAAGCGGCGAGGAAGGCGAAGAAGAGGTAGTAGAGGCTACAGATTGTATCAGGCCTCCTGTGAGCAATGCACGTGCAGAAGAAAACGATGCGCGTGCAAACCTTAGCGATCGTGACTCACGCTCCACGAAAGCGAAAGAGGAAGCCAGTTTAACGCAAACTGTGCAAGCGAATGGTCATGAAAATGCAGAGGAAGAGATTGAAGCTGGTGGAAATGAAGTTCAAAGTCAAAAGAAGAAACGAAAGCGACGAAAAAAGAAGAAACACGATTCTGAAACTGCAAGTGAAGCAAGTGCTACGTCAGCAGGTACCAGCTGTGATGCAATAAAGGAAGAGGGTGATGTTACACAGACGACATCGCCTGACTCAGCTAAACAAGTGAATCATGATTGCGCTGACAAAGGTGTAGACGAGCAAAATCGCGTTCATTCAGAAGCGACTACGAGCCAAGACCAAGCAGACGACACGAAAAAGCGAAGATCGAGAAGAAAACGAGGAAAAAGCGCACAGTTGAGCGAAGAAACTCCATTAGTACAAGAAGACATGGCAAAGGGAGGCGATGTGAGCTCAAACCTCCCAGCGGAGGGCGGTAAAGAAGAACGGCAAGATTTGCTGACTCCTGAGAATGCGAGTAGCGGAAAAAAGAAGCGAAACAGACGAAGAAAAGGGAATAAAGGTCATCATGATGGCGATAGCCTCGAAGCGAGTGGTGGAATGAGCCTGGATAACTCTGCGCGAAAAGATTGGCATCACAGTGAACCGCGAAACGGCAACCAGCATCAAGTTCAAGGCTCGGAGAGAGATTCGGAGACAAGAAGTACGAATCACGTGACTCCAAAATCTCACGAAAGATCTGCGAGGAGAAATTCGCCTCACAGAACGCCAAATATCATAAAGACCGCTGGCAACAAACGAAGGCCTCTCTACGACCAGCACTGGTCTGTAGAGAAAGTATCAGCCGGTTTAAAGAGAGGAGAGCTTGTGAAAGGAGTGCTAAGGATAAGCCCGCGAAACTATGAGCTGGCCTGGGTGACAGTGCCTGGACTGAAACGTGATGTGGTGCTAGAAGGAATGTTAAGACGCAACAGGGCTCTTAATGGCGACGTGGTTGCACTGGAGATTTTACCCAGAGACAAATGGAAAGTGATGAAGGAGGAGTTGGACTATAGCGGCGTGACTGTGCGTGACGCGGATCACAATCACGCAAGCGTCGACAACGTGACAGAGAAGTTGGATAGCTTGTCTATGAGCCCTGGGAATAGCACACAGTCCCCTGTCACACCAACCGTGCATACGCCCGGAACACCGCACAAGGATCGCATTGATATTGATAAAATTCCAGAGCAATTCTTGCAAAGAACTGGCAAGGTTGTGCATATAATTGAAAAGAAACACTCTCGTGTAGCAAGCGGACATCTGAAGCCCTTCACCCACCCCAAGGAATGCCCCGATGGATTATTCTCCCCAACTGACAGTCGGTTGCCAAGGATACGTATCATGCGTGAGAACTGCCCGCCGGGATTCTTTGACAGACCACGTGACTTTGAAAACACGCTGCTTGTGGCGCGTATTGAATCACCTTGGAAGATACCCGAGAAGGAGCTGGACTACAGAAGGGATTTCCGCGAGGATTGTATCTTTACGATTGATCCGCTGACCGCGAGGGATCTGGATGATGCAGTACACTGCAAGAAACTTGAAGATGGCCTCTTTGAAGTTGGTGTCCACATCGCCGATGTCAGCTTCTTCGTTCGCCGAGGGACAGCGCTGGACGAAGTGGCCGCAGAAAGAGGAACATCCACGTACATGGTGCAAAAAGTCGTACCCATGCTCCCGCGCCGTCTGTGCGAGGAACTGTGCAGTTTAAACCCGGGCGAAGATCGTCTCACATTCTCTGTTGTTTGGCAAATGTCCGATAAAGGTGAAATACTAGACGAGTGGAAAGGACGAGGGATCATTCGCTCACGTGTAAAGATGGCCTACGAACACGCCCAAGATATGATCGACAAACCAAACAGGAAGTGGAATCTAAACGAACTACCCCCGATATCTGACGGTGCGAGCGTGGAGGAGATCTCCGCGCAGGTCAATCAACTTCATAAGTTTGCGCTGCGTCTTAGGCGCAATCGTTTCGAAAATGGCGCGCTGCGCCTCGATCAAGTAAAAATCCGGTTTGACCTGGATAAAGAAACCGGTTTGCCCAATGGCTATCACGTGCACAAACAGCGCGAAGCGAACCAGTTGATTGAAGAGTTTATGCTGCTGGCCAACATGGCGGTGGCTCATCACATCTATGGCGCTTATCCAGAGACAGCGCTACTGAGACGTCACCCCAAGCCTCACCAGAAACAACTCGACGATCTCATCGAGTTGTGCAAATCGTTTGGTATCAGATTCAACGCGACGTCATCCAAGACCATTCACGAGTCGCTAGCACAATTCCCGCTGTCCTCCCCCGAGCGTGAAGTTTTGGTCAACTTGACCATGCGTCCGATGAAGAACGCGGAGTACTTTTGCACGGGTCCGTAG

Transcript

OS493_029825-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CI75	DIS3-like exonuclease 2 OS=Mus musculus OX=10090 GN=Dis3l2 PE=1 SV=1
Q0V9R3	DIS3-like exonuclease 2 OS=Xenopus tropicalis OX=8364 GN=dis3l2 PE=2 SV=2
Q8IYB7	DIS3-like exonuclease 2 OS=Homo sapiens OX=9606 GN=DIS3L2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007567 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17849 all species →	OB_Dis3	Dis3-like cold-shock domain 2 (CSD2)	Domain	Interproscan
PF17216 all species →	Rrp44_CSD1	Rrp44-like cold shock domain	Domain	Interproscan
PF00773 all species →	RNB	RNB domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041505 all species →	Domain	Dis3-like cold-shock domain 2	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR033771 all species →	Domain	Rrp44-like cold shock domain	Interproscan
IPR050180 all species →	Family	RNR Ribonuclease	Interproscan
IPR001900 all species →	Domain	Ribonuclease II/R	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23355 all species →	RIBONUCLEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000175 all species →	Molecular Function	3'-5'-RNA exonuclease activity	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0006402 all species →	Biological Process	mRNA catabolic process	Interproscan
GO:0010587 all species →	Biological Process	miRNA catabolic process	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004540 all species →	Molecular Function	RNA nuclease activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029825-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029825-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

98TPM > 0

7Conditions

56.3Max TPM

20.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	24.88	41.37
polyp at pH7 6	18	18	23.93	38.46
coral polyp · control treatment	16	12	19.02	56.26
coral polyp · oil and dispersant treatment	16	13	23.72	55.35
coral polyp · oil treatment	16	14	15.73	28.31
coral polyp · dispersant treatment	16	13	20.11	50.44
Polyp	10	10	8.96	13.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.37
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.07
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.44
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.72
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.18
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.18
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.68
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.35
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.15
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.42
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.49
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.05
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.52
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.44
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.33
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.28
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.88
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.21
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.12
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.80
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.73
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.75
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.20
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.70
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.06
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.36
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.26
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.21
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.35
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.86
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.13
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.81
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.82
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.53
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.54
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.44
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.64
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.64
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.66
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.96
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.70
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.65
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.99
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.86
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.02
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.92
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.63
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.93
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.99
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.29
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.93
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.71
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.69
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.17
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.08
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.43
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.35
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.64
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.26
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.06

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.