Gene detail

Detailed information of OS493_029826-T1 in Lophelia pertusa

Genomic Location: scaffold_185:200793...214856
NR annotation: KAJ7354820.1, hypothetical protein OS493_029826 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029826-T1

ATGAGTGCAGACTCTCAAACACTGCAGGCAAAGTATCAGAAACTGGCTGCAGAATTTTCGAAGCAAAGAGCACAGAACACCGTTTTAAAGAAGGCAGTGATTGAGGAACAAGAAAAAACAAAGACACTTCAGGACACTGTACGGCAGAAGGACCAGTCTATTAGGAAATATGAACAGGAGATTGACAGCCTGCAGTTTAGAAATGACCAGTTGTCTAAGAGAGTGGCAGTTCTACAGGAAGAGCTTGATGATCATGATGGAAAGAACAGGACTAGGGGAAAGTCGAAAATTGATGGGATGGCAAGGGGCGATGACAATGACGTGAAAGATCAGGAACTTCAGATTAAAATTCAAGAAAATGAGAGACTTCAGAGAGAGTTATATCAAACAACCGTAGAACACAAAGGAACAGTACTGACGCTTGAGTCAAAGTTAGAGGATCTACAAAGAAATTCCACTGATCACCAGAAGATTTTAGATGACGCTAGTGGGAAACACAAAATGGTTATTGATAAACTTAATGAGGAGAGAGCCATGTTAGAGGCTAAACTCCATAAGACAGAAGAAGAATTAAAAGTAGCAAGTTTAAAAGCAGAGAAAAGCCACCATCAGCTCAAACTCTTACACAAGGAAATGACGTCCAGATATGATGATGTCTCTAAGGTTGTGACGGAAAAACTTCCATTTAACGATACAAGCATCAGAGAGTTGAACAAGCTCAATGTACCAACACATGATCGCAGGCATCAGGTGAAAGCAAAAGAAATAATTTGTCAAGCAGTTGAACTGGTCCGTGAGCTTGTATCAGGGATGTCAAACTTCCTTACCTACACTGAACAGCGACTCAAGACATTCTTTGTGGAATCCTCTCAGCAGCAGATTAGTCCAGTTACACAGAAGTTTTGTGACTACCTTCATGAAAATGCGGCAGTGCTGCGAGCTGTGGATCAGGCATTTGTATCATTCTATAACAGCATCAAAACAGATTCTTTAATTTCAATGGAGACTATACCTGGTTTTCTGGATTTTTCTGAAGCATTCCACAGATTTAACAACTACTTGAAGAAACTCCTACCTTATTTTGTATTGAGTACTAGCGAGGAATGTAAATCCTCAATTTGTTCCAAAACACTGGAGGCCTACAACAAAGCTGTACTGCACTCTCTTAGAAAGCTGATCACGACATTCAGTAAGATTGACACTCACATTGGAGTCCTAGCCTCAGCAAGTTCAGAGTCTAGAGGAATTCTACCAACTAATTACAACCTGTCCTTCATGCTTCTGAATGCATCCTTGCAGGAACTCCATGAATGTGTCACAGTGTTGTCAACACATTTCCAGTCCAAGGTATCCCTTGAACACCAGCTGCCGACGGCGACACAGACCTTGAAAAGTACAGATGAATGTATCGTCTCTTCTCTAGTGTCCCTGCTGACTGCTACTGCCAAGATAGGAAGGTTCATGAACAGCAACCTGGAATTTATCTCAGCCAAGTCTGGCATCAGAACAAGAGGAATGACAACTGCAGCTAACAGCGAGCTGACATCTTCCCCAGCTGTAGTAGACTTCAGACATCATGCTGCTGATTACATTCAAAAGCTAATGAGGCCCTGCCCAGAGGCCGTTCCTTACAAAGTAGCGCTTTATAATCACAAGATCCTGGTCAGTTCGACAGAAAGCAAAGATTCTTTGGAACAACAGATTGCTTTGACTCATGAGAGAGTTTCCAAGCTTGAACAGGCCAAGGAACATTGGATGTTGGAGTCTCAACTATTACAAGTGAAATATGAAAAAGAAGTGAAGAAAGTGCGAACTTTGGAGGCAGAGCTAAACCGGCTTATGGAATCGAAAGGTGTGCTGCTGACAGGAGACGGACTCTCGCTTGGAGCTGTAGCGTCACTCGACCGAGATGAGGGAGCGGAAGAAGTGACGAGAGAAGCACTGATCAAGAATCATTTTACACAAAGAATAGTTGAACTAACTTCTCAGGTTCAATTTACGGAGAGCAAGACAGTATCCGTTAATGCGGAGTGTCGCGCTCTTTACCGACGAATGAAACAATCGGAGAAGACAAAACAAGATCTGGCGAAAAAGCTCAAGACTGCAACCTCCAAAGTCAGCCAACTAGAGGACGAGGTAGAGACGATCAAGCGAAGCTACGAGACACAGTTATCCATGATGAGCGACCATTTGTGCGGAATGAACGAGAAACTCACTTCACAACAGGATGAAATAGAGGTGCTGAAGAGTGGCAAGCTTAAAAAGGGAAAGCGGTGA

Transcript

OS493_029826-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6ZMI0	Protein phosphatase 1 regulatory subunit 21 OS=Homo sapiens OX=9606 GN=PPP1R21 PE=1 SV=1
Q6IR70	Protein phosphatase 1 regulatory subunit 21 OS=Xenopus laevis OX=8355 GN=ppp1r21 PE=2 SV=1
Q5ZL12	Protein phosphatase 1 regulatory subunit 21 OS=Gallus gallus OX=9031 GN=PPP1R21 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005706 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10205 all species →	KLRAQ	Predicted coiled-coil domain-containing protein	Coiled-coil	Interproscan
PF21636 all species →	PPP1R21_C	Protein phosphatase 1 regulatory subunit 21, C-terminal	Coiled-coil	Interproscan
PF10212 all species →	PPP1R21_helical	Protein phosphatase 1 regulatory subunit 21, six-helix bundle	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019343 all species →	Domain	Protein phosphatase 1 regulatory subunit 21, N-terminal	Interproscan
IPR040024 all species →	Family	Protein phosphatase 1 regulatory subunit 21	Interproscan
IPR049372 all species →	Domain	Protein phosphatase 1 regulatory subunit 21, C-terminal	Interproscan
IPR019348 all species →	Domain	Protein phosphatase 1 regulatory subunit 21, six-helix bundle	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21448 all species →	SMOOTH MUSCLE MYOSIN HEAVY CHAIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005769 all species →	Cellular Component	early endosome	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17562	PPP1R21, CCDC128, KLRAQ1; protein phosphatase 1 regulatory subunit 21	-	Protein phosphatases and associated proteins	ko01009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029826-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

42.9Max TPM

18.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.89	21.32
polyp at pH7 6	18	18	20.33	25.53
coral polyp · control treatment	16	16	21.11	37.95
coral polyp · oil and dispersant treatment	16	16	25.55	42.89
coral polyp · oil treatment	16	16	16.84	26.54
coral polyp · dispersant treatment	16	16	14.63	21.80
Polyp	10	10	9.21	14.72

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.86
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.35
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.06
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.31
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.93
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.61
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.56
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.02
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.89
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.41
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.48
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.05
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.31
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.32
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.65
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.46
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.18
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.95
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.35
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.51
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.95
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.04
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.28
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.29
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.54
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.81
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.34
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.85
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.94
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.50
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.87
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.54
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.13
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.82
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.15
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.95
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.94
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.22
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.98
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.41
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.13
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.61
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.72
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.65
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.35
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.51
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.93
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.27
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.77
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.72
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.10
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.94
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.02
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.64
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.42
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.07
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.97
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.73

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.