Gene detail

Detailed information of OS493_029911-T1 in Lophelia pertusa

Genomic Location: scaffold_186:552086...572680
NR annotation: KAJ7325361.1, DNA repair and recombination protein RAD54-like [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029911-T1

ATGAGGAGATCTCTTGCTCCGAGTCAGATTCTTAAAAGGAAGCAAGACTGTTTTGAGGAAGAAGAAAGTGGAAATAGACGTAAACAGAAGTTCAAGCTTGGTCCAACCCGAGGTGATGACAGCACTGATGTTATCAGAAGAGTACTTGCTCCACTTTCCACTCAAGAAAACCACGACTCAAGCGACTTCTCAGCTCATGAGGTGCTGATTCGCAAGATTCTTGCCAAGCCTTTCAAAGTTCCCATTCTAAACTATCAAGGATGTACCTATACAAGAGGGCTTGGTATCAAGAGAAAAGGGCCTCGCAGAGCACTTCATGATCCTTTTGAAGAAGACGCTCTGGTTTTATATTCTCCACCTGAACTCACGGCTCATGAGAAGCTTACAGCAGATCTGGAGAGTCAAGAAGTTCATGTTGTTGTCGATCCACTGCTTGGCAAAGTTCTCCGTCCTCACCAAAGAGAGGGTGTAAAGTTTTTGTATGACTGTGTGACTGGCCAAAGGATCAATGGCAGCCATGGATGTATCATGGCTGATGAGATGGGATTAGGGAAAACGTTGCAATGCATCACATTGATATGGACTTTAGTGAAACAAGGCCCAGATGGTGAGCCAATAGCCAACAAAATTATTATTGTTGCACCATCAAGTCTTGTTAAGAATTGGTACAATGAACTGCATAAGTGGCTTGCTGGAAGAATTTCTGCTTTGGCCATTGATTCTGGGACAAAGAATGAAATTGACAAAAAACTTGGAATGTTTATGTCTCAGCAAAGAAAGCGCACAGCTTATCCAGTGTTAATCATTTCATATGAAACTTTCCGACTTCATGCCTCGGTGTTACAATCTGGCCCTGTTGGATTAGTCATCTGTGATGAGGGGCACAGACTAAAGAATTTAGAAAGCCAGACATACCAGGCTCTGGATAAATTAAAGACAACACAAAGGGTACTCTTATCAGGTACTCCTATTCAGAATGACTTATTGGAATATTTCAGTCTGGTTCATTTTGTAAATAGTGGAATTTTAGGCACAGTAGCAGAGTTCAAGAAAAAGTTTGAGAATCCTATTTTGAGGGGAAGAGATGCTGATGCATCTGATGCAGACCACAAGAAAGGAGCAGAAAAATTGACAGAGCTTGCTTCCCTGGTGAACAAGTGTATTATTAGAAGAACTGCATCAATATTGTCCAAATATTTGCCAGTGAAAGTTGAACAGGTTGTGTGTTGTCGCTTGACTCCTCTACAGTCAGAACTCTACAAACTTCTAATACAGTCTAAAGTGTTAAGAATGGAAGTTTTGAAATCTAAGTCTGGATCTGGGATGTCTGCATCGTCTCTGGCTTTTATCACCCAACTAAAAAAACTCACTAATCATCCTGAATTGATATACGACAAAGCTCAAACTGGAGAAGATGGATTTGAAGGAGTGCTTGATCTGTTTCCTCAGAGCTTTAACCTGAAGCAAGTACAGCCAGAACTTTCCGGGAAGATGCAAGTGTTGGATTACATGTTAGCAATGACAAAATCTACCACTACAGACAAGGTTGTTCTGGTTTCTAATTACACACAAACTCTGGACTTGTTTGAGAAACTTTGTAGGCTTAGACGGTATCAGTTTGTTCGTCTTGATGGGTCCATGTCCATCAAAAAACGGCAAAAGATTGTTGACCGGTTTAATGATCCTCATGGTGGGGACTTTATATTCATGCTCAGTAGCAAGGCTGGTGGATGCGGCTTGAATCTGATTGGAGCCAACAGACTTGTGATGTTTGATCCTGACTGGAATCCTGCCAATGATGACCAGGCGATGGCTCGTGTGTGGAGAGATGGACAGAAGAAGAAGGTCTTCATTTACAGACTGTTGTCAACTGGTACTATTGAGGAAAAGATCTTTCAACGGCAAGCCCACAAGAAAGCACTAAGCAGCTGTGTTGTAGATGAAGAAGAAGATGTAGAAAGACACTTCTCAGTTGGAGAGTTAAAAGACTTGTTTCGTCTGAATGAAGACACCCTTAGTGATACTCACGACAAATTCAAGTGCCGTCGATGCGTAAACAACATTCAGGTTCACCCTCCCCCTGAAAGTACCGATTGTAGTGGAGATCTTTCACAATGGCATCACTGTGCAGATCGGAAGGGATTGGAAGACATAATGTTAAAGGGTGCATGGTCAAGTGGCGTAACCTTTGTATTTCACCAGAAATCACACGAAAAACAACTGGGCCTTTGA

Transcript

OS493_029911-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1Q8K0	DNA repair and recombination protein RAD54-like OS=Danio rerio OX=7955 GN=rad54l PE=1 SV=1
Q92698	DNA repair and recombination protein RAD54-like OS=Homo sapiens OX=9606 GN=RAD54L PE=1 SV=2
P70270	DNA repair and recombination protein RAD54-like OS=Mus musculus OX=10090 GN=Rad54l PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001229 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF08658 all species →	Rad54_N	Rad54 N terminal	Family	Interproscan
PF00176 all species →	SNF2-rel_dom	SNF2-related domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR050496 all species →	Family	SNF2/RAD54 Helicase and DNA Repair	Interproscan
IPR049730 all species →	Domain	SNF2/RAD5-like, C-terminal helicase domain	Interproscan
IPR013967 all species →	Domain	Rad54, N-terminal	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000330 all species →	Domain	SNF2, N-terminal	Interproscan
IPR038718 all species →	Homologous_superfamily	SNF2-like, N-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45629 all species →	SNF2/RAD54 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0007131 all species →	Biological Process	reciprocal meiotic recombination	Interproscan
GO:0015616 all species →	Molecular Function	DNA translocase activity	Interproscan
GO:0045003 all species →	Biological Process	double-strand break repair via synthesis-dependent strand annealing	Interproscan
GO:0016817 all species →	Molecular Function	hydrolase activity, acting on acid anhydrides	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0140658 all species →	Molecular Function	ATP-dependent chromatin remodeler activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10875	RAD54L, RAD54; DNA repair and recombination protein RAD54 and RAD54-like protein	EC:5.6.2.-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029911-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

110.3Max TPM

20.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	21.41	69.60
polyp at pH7 6	18	18	19.52	73.46
coral polyp · control treatment	16	16	22.46	110.34
coral polyp · oil and dispersant treatment	16	16	17.03	102.22
coral polyp · oil treatment	16	16	16.64	69.91
coral polyp · dispersant treatment	16	16	10.89	47.20
Polyp	10	10	43.48	74.47

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	69.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.52
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.71
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.24
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.28
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.16
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.02
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.89
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.87
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.59
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.46
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.47
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.45
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.74
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.08
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.94
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.40
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.26
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	110.34
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.58
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.81
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.81
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.48
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.78
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.18
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.10
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.50
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.22
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.88
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.93
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.13
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.27
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.59
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.90
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.10
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.91
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.46
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.75
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.66
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.42
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.14
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.40
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.17
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.02
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.91
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.82
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.20
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.28
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.60
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.85
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.65
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	74.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	71.60
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	54.97
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	54.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	53.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	49.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	34.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	30.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.42

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.