Gene detail

Detailed information of OS493_029983-T1 in Lophelia pertusa

Genomic Location: scaffold_187:642041...650642
NR annotation: KAJ7389644.1, hypothetical protein OS493_029983, partial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_029983-T1

GTGAACGATACTCGGTTCGATGGAATCAGCGATTCCTGGACCCTCAGACCGTTTACAGCCATTTGTTACCTAACAAGATCTGTCCTTGCCTTGAAATACTATTTGTATAAGAAGATTAAAAGAGCAGCCTGTTTCAGTGGACTGGATCGAGACAGGCTGGATAAGCGGCCGCAAGCGGAGGTGGTTGTGACTTCCGTTATTGTGCAGACAAAACGGCCGTTTAACATGGGAGCGATTCCCGAGCAACATAAAGGTACAGACGATGAAACTTCAGTAAAACTAAGTGAACTACACACAAAAAACGAGCAAGAAGTGGAGCAGGAAAACGTAACTGACGTTACTGAAATAGTTGAAAAACTTCATTTTCACCGCAACGCAACTTCTTTTGAAACATATTTTCTTAGTCGAGGAGGAGAAAAAGATAACAGAATCCAGGCAAAGGAAACACATGAGCACAAAATACATCGTCTGCCGCCTTCAGACATAATTGGAAAAGTTGCGGAAGAAATTTTGCGAAAAGCAAACGTGTCTGAAGAGGAAGCTAACAGAGAACTTATTCGCGTCGAAAAAGTCGATGATATTGTCGACAGGGAGAAAGAGCACAGAAAAAGATTAAACAAACAGGAGCATTCGTTTCTGGAGAAGGTGAAAAAGTCGAGAGGTGCCGGTGGGAAAAGCACAGAGAAAAAGCTTGTGCGAGTTGAAAGAGTTGACTTGACTGATGAAGAGGAGGAGGAAGAGCCAGAAAAACCAGTTAAACCAGCTTATGATCCAGTTAAACCAGTTAATGATCCGGTTAAACCAGTTTATGATCCGGTTAAACCAGTTAATGATCCGGTTAAACCAGTTAATGATCCGGTTAAACCAGTTTATGATCCGGTTAAACCAGTTTATGATCATTCGCGCACTCAGAAAAGAGCGCAATCAAACAATGGTTCTATTGATGACGTCCCAAAGGCGAATACGTCATCGAGAATGGGACCGGTGGGTGTAATCTCTAAGAATGACGATTTCGAATCAGCACATGCAAGAAGATTCGGGAAAACGAATGCGGTGAACACCACTTTTAAAAGTAATTCCTCGGCAGTAAAGCGAGAAGAAAGCCACGTCAATAAAACGAGGGAAGAACTTGCAATGACGCCCCCGCCCTTCTTTGCCAAGTTTTTGAATATCACCGCACAAGAAAGAGAAATGATCGATCTTCTTCATAACTATACCGACACCAGCAAAGTGCGCCATGAAGGGACCGCGTTAAACATTACTCATCAGAGGCTTGGGACCGAGCAGAAAGAGCCGGACAAGATAGCGCAAAGATTTGACGTGTCATCTGCGCATGCGCACGCGGATAAGGTCGAAGTGCGCACTAAAAGGAACCACAAGGAAGGTGATTTTCGTGACACTCTTCAACCCTTGATAGCAAAGCTGTTAAACCTTACAGGGGACAGGCAAGAAGCGTCATCAACGCATAATGACTCTGAAAATTTGAAAGGACCGTTCAACTTAAGTAATATTCTTGGCAAAATCACCCAAGGTGATCAAAGTCTTGCTACAAAAGACGTGCAGTCTTCCGTCCCAGATAGCACTGCACTGTTAGTCCGATTTCTACAGGAGGGTAGTCGCTACATACCGCGCATGCCTAAAAATGACACCGCTGTGCATACAGACAAAGATAACAGTAAAATGGCTGCTACGAAGCTTGGAAGCAAAAAATCAGATCTGACGCCGCTTTCGGGAGAGGCTATAAATCTGAAAGAAACTCTCTTAAAACTGGCAAATCACATTGACTTGACCAGCCGCGTGCTGAAAGAAATAACGGAGAGCTCTTCTCTTAAGAGTAGCTTAACTGCTCTGGCACCGATAAAAGTGAAGCGAGATGAGGATGCGGATGAACTGGGTTCTACTCGTGCCCAGTCTGACCTGAAGATATTTCGACCTGTTGCGGATAAACTGGAAACTAGCAAACCGGAGCTGGTTTTCAACTCAGATAGAAAACCGAGCAGTTCGTTAGAAAGTGTGGGAGTGGGAACTCTTGCTTCCCCAAATGGCAAGGCGAGGGTCGACAGAAAAATTAATGCCTCGTTTTCGAGTGGAAGTGGTACAGGGGAGACTGGGGATGAGGAATTTGGGAGAAGTAGTGACACTGAGAAGCGAAAGAATAGCAACGCGACAGCGAAGGTGCAATCTGAGAAGAAAGAACGATCGAAACTTGGCACAAATGGAATTTTGAGGTATCACACTTTCCGTTGCGAGGCATTGGATCCAAAAGTATTACTGTATAATCGTATTTTCAAGACTGGAAGTTCAACAACTGAATCTATAATTATGAACTCGAGTGCAGGCATGAATTACGACTACAAAATAGGAACAACTGAGGATTGGTATGACAAAGGCAAGTCCCACACATATCCGGGACTTATCATCAGAAAAGCCAACAAAAAACTCATCAAATATCCACGCATGGCATTCGTGGCGCACTTTTATTTTAGGAGAAATCTCAACTTACCGCAGGCTCACACGTACATCAATCAAATAAGGGACCCAGTGAGACGGCTAGTGTCGCATTATCATTACATGAGAAGTAACAACCGGCCTGCGAATAGAATTAAGGAATTTCGCGCGTCTGGCGAAAAGGACGAGTCTCTTGATAAATGCTTCAGATTGCAGCATAGAGGGTGCAAGAATAACGTCATGACAAGATTCTTCTGCGGCAGACATTTTTATTGCCGCAGAGGAAATGGCAGAGCGTTGCACAAGGCCATGAACAATATCAAGCGATTTTATGCCACTGTTGGTTTACTGGAACATTACGACATTTATCTTCAAATACTCCACAAGCTTTTGCCAAAGTTTTTTCCGAAAGTTTCCAATCATGATATTGGTAAATTTAAGTACAATTCGAAGTACAATTTTGATGACATTTCTAAGGACCTCATTGGAGCCATCACCAGGGCAAACTGGGCTGATGTTAAACTTTACTCGTTTGTTAAAAAGCGCTCTTGGCAGCAAGCTAAAGCCTGCGGTATTAGGTATTAA

Transcript

OS493_029983-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O17645	Heparan sulfate 2-O-sulfotransferase hst-2 OS=Caenorhabditis elegans OX=6239 GN=hst-2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002447 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03567 all species →	Sulfotransfer_2	Sulfotransferase family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007734 all species →	Family	Heparan sulphate 2-O-sulfotransferase	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR005331 all species →	Family	Sulfotransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12129 all species →	HEPARAN SULFATE 2-O-SULFOTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004394 all species →	Molecular Function	heparan sulfate 2-O-sulfotransferase activity	Interproscan
GO:0008146 all species →	Molecular Function	sulfotransferase activity	Interproscan
GO:0015014 all species →	Biological Process	heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Interproscan
GO:0015015 all species →	Biological Process	heparan sulfate proteoglycan biosynthetic process, enzymatic modification	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_029983-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_029983-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

15.1Max TPM

4.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.35	8.35
polyp at pH7 6	18	18	4.83	10.62
coral polyp · control treatment	16	16	6.22	15.05
coral polyp · oil and dispersant treatment	16	16	3.99	7.62
coral polyp · oil treatment	16	16	5.14	11.10
coral polyp · dispersant treatment	16	16	3.21	6.36
Polyp	10	10	1.60	4.83

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.35
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.88
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.25
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.39
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.03
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.26
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.00
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.84
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.39
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.30
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.13
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.53
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.62
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.41
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.98
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.46
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.36
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.83
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.67
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.53
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.67
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.62
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.57
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.16
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.05
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.08
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.98
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.26
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.86
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.31
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.58
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.29
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.62
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.68
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.47
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.26
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.21
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.75
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.33
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.88
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.83
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.52
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.14
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.02
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.12
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.66
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.49
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.98
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.72
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.93
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.02
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.20
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.36
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.09
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.19
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.24
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.95
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.65
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.43
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.04
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.35
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.89
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.67
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.58
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.56
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.46

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.