Gene detail

Detailed information of OS493_030064-T1 in Lophelia pertusa

Genomic Location: scaffold_189:199697...213572
NR annotation: KAJ7377253.1, Acyl-CoA dehydrogenase member 10 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030064-T1

ATGATTCCTCAACTAAGAAGTTTAAGGTATCTTCATCTTCGCGCTTTGCGCCTGTTTCATCCTCGGCATTATGCCAGCCACCCATCAATCAAGCCAAAGGCTGTGGCATTTGACATGGGAGGAGTGGTGGTACCTTCGCCGTCACCCCTGTTTGCTCAGTTTGTAGATAGCCATGGTCTCCAGAGAGGCTCTTTAGTCTCAGCTATCAATGCTGGTGGTGAAAGAGGTGTCTGGGCACAGCTGGAACGTGGAACACTTTTACCAGAGGAATTTGCTCGGAAATTTGGGGAAGTCCTACAATCCATGACTGGAAAAAGTGTAAATATGAAAGAGCTGTTACCAAGCATTGAGACAGCAATGTTTGAGCCATATCCTGAAGTACTAACAGCAATTGAGTGCATCAGAGCAGAGGGCTTAAAGACTGCCTTGGTTACAAACAACTGGTTGATGGAAGATGGAAAGTCATTTTGCCCAGTAGATCGGAAACATTTTGATGTAGTGATAGAGTCAGCAGTGGAGGGCACAAGAAAACCAGAGGAACGATTTTACCTCACGTTGCTTGACAGACTCAAGATGAATCCAGAGGAGGTGGTGTTTCTAGATGATCTTGGCCCAAATCTGAAGGCTGCACAGAAAATGGGATTTCGCACAATTAAGGTTGATGATGTCAGAAGTGCTTTGAGTGAATTGGAGAGCATACTTAATTTTCCACTAAAAGGATTTGCTCCAGGAACCACTGCTGTGCGTAAAACTCACCAGATTCCTGTCGATTCTCTTGTTAATTACCTGCAGAATGAGCTTGGTTTGCACCAAGAAGATCCCCCCACAGTTCGTCAATTTAAACATGGCCAATCTAATCCCACATACTATGTGGAATATGGAGGACAAAGGCTGGTGATTAGGAAAAAGCCTCCTGGGAAACTTTTACCATCTGCACATGCTGTGGAAAGGGAATACAAGGTGATGAAAGCACTTGGATCTGCTGGAGTTCCTGTTCCCAAAACGTTAGCCTTATGTGAAGACACTAGCATTCTGGGTACGCCATTTTATGTCATGGAATACGCTCAAGGGCGCCTGTTCAAAGATCCATCTTTACCTGGCATGACAGTGGAGGAAAGAAAAGAAATTTATCACGCGATGAACGAGACTCTTTTCAAGATTCACAACGTTGACATCGATGCTGTTGGTCTTGGAGACTTTGGCAAAAGAGGGAGCTACATTCGCCGTCAAACAGAGAGGTGGGCCAAACAATACGAAGCCAGCAAAACACAGGATATACCAACCATGGACAAGCTTATAGCATGGCTGTTAGAGAATGTTCCAGCAAATGATACGACAACAGTTGTCCATGGAGATTTTAGGTTGGTTAGACAATTTAATTTTGACGAACAAAAGCCAGAAGTAATAGCTATTCTAGACTGGGAACTATCGACTCTTGGTGACCCGCTGTCCGACGTGGCATACAACTGTCTGCCTCATCATCTTCCTCCAAATTTCCCGGCTCTTAAAGGCTTTGCTGATCGTGATCCTAGTTCACTCGGCATTCCAAGTGACACGCAGTACATGCAGGAATACTGTCAGCGAGCAGCTATTCCTCCTGTCGACAACTGGAACTTCTACATGGCCTTTTCGTTTTTCCGTGTGGCTGCCATTCTCCAAGGAGTGTACAAAAGGGCGTTGCAAGGACAAGCCAGTTCAGAAAATGCCAAATCTGTGGGTATGCTGGCCGAGACGATGGCTAAGACCGGGTGGAAGTTGGCTTGTAAAGGGTCTGGGTCCAGCAGTGGTACCAGTGGAGGTGGCCTGGGAGGGACAAAGAGAATGTATTCCACGTCTTCCCACGTGGCTACACCAGGTCCATTGCCAATTGACCTGATGTCTCTTCCGTCCCGTGTGCAAGAAATGTACAAAAAGCTAGCAGATTTCATGGAAGAACACGTGTATCCGAATGAGGCCGAGTTGAATAGGCACCAGGCCTCTGAGCATTGCTGGACTCCTCATCCACTGGTGGAAGAGATTAAGGAAAAAGCCAGATCAGCAGGATTATGGAACCTGTTTGTTCCAGTTGAGGCGGATCCTGATGTCAGATATGGCGCTGGATTAACAAATGTGGAATATGCTTACCTGTGTGAGATGATGGGAAAATCAATTTACGGACCTGAGATGTTTAACTGTTCTGCTCCAGACACGGGGAACATGGAGGTTCTAATCAAATACGGCACGAATGAACAACAGGAGAGATGGCTGCAGCCTCTTTTAGATGGAAAAATAAGATCGTGCTTTGCTATGACGGAGCCTCAGGTAGCTTCATCAGACGCAACCAACATCGAGTCTTCTATTACTCTGGATGGAGATCATTACGTCATCAACGGACACAAATGGTGGACATCAGGTGGCATGGATCCACGATGTAAGATCTGTATTTTTATGGGAAAAACTGATCCTGATGCTCCAAGACACAAACAGCAGGCAATGATCCTTGTACCTATGGACACACCTGGAGTCACTGTTGTACGACCTTTGTCTGTTCTTGGCTACCAAGATCCACCATGTGGGCATGCTGAGGTCATTTTCCAAGATGTTCGAGTACCTAAGGAGAACATTTTGTTGGGGCCTGGGAGAGGATTTGAGATTGCTCAGGGTCGCTTGGGCCCAGGCCGTATTCATCATTGCATGCGCCTGATAGGTCAGGCCGAGAGATCCCTGGAACTGATGATTGAAAGGGTTAAGAGCCGAGTGGCTTTTGGCAAACCTCTTGTTCAACAAGGAACCATTTTAGAAGACATAGCTGAGTCAAGGATTGAGATCGAACAGGCCAGGCTTCTAACCCTGAAAGCTGCTCATCTAATGGATACAGTAGGAAATAAGGTCGCAGCTCCAGAGATCGCCATGATTAAGGTCATTGCTCCGAGAATGGCGCAAAATGTCGTCGACAGAGCCATGCAGGCATTTGGTGGAGCGGGTCTTTCTTCTGATCAGCCGCTGGCCCAGTTTTGGTCGTGGGCTCGCATTCTTCGTCTAGCTGACGGTCCTGACGAGGTGCATCTTGGGGCTGTGGCAAAGCGAGAAGTGAACAAAGCCAACACCAAGGAATAA

Transcript

OS493_030064-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8K370	Acyl-CoA dehydrogenase family member 10 OS=Mus musculus OX=10090 GN=Acad10 PE=1 SV=1
Q6JQN1	Acyl-CoA dehydrogenase family member 10 OS=Homo sapiens OX=9606 GN=ACAD10 PE=1 SV=1
Q8RWZ3	Probable acyl-CoA dehydrogenase IBR3 OS=Arabidopsis thaliana OX=3702 GN=IBR3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001332 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01636 all species →	APH	Phosphotransferase enzyme family	Family	Interproscan
PF02770 all species →	Acyl-CoA_dh_M	Acyl-CoA dehydrogenase, middle domain	Domain	Interproscan
PF02771 all species →	Acyl-CoA_dh_N	Acyl-CoA dehydrogenase, N-terminal domain	Domain	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan
PF00441 all species →	Acyl-CoA_dh_1	Acyl-CoA dehydrogenase, C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041726 all species →	Domain	Acyl-CoA dehydrogenase family member 10/11, N-terminal	Interproscan
IPR002575 all species →	Domain	Aminoglycoside phosphotransferase	Interproscan
IPR046373 all species →	Homologous_superfamily	Acyl-CoA oxidase/dehydrogenase, middle domain superfamily	Interproscan
IPR006091 all species →	Domain	Acyl-CoA oxidase/dehydrogenase, middle domain	Interproscan
IPR013786 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, N-terminal	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR006439 all species →	Family	HAD hydrolase, subfamily IA	Interproscan
IPR050741 all species →	Family	Acyl-CoA dehydrogenase	Interproscan
IPR037069 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal domain superfamily	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR011945 all species →	Domain	Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal	Interproscan
IPR023198 all species →	Homologous_superfamily	Phosphoglycolate phosphatase-like, domain 2	Interproscan
IPR009075 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, C-terminal	Interproscan
IPR036250 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase-like, C-terminal	Interproscan
IPR009100 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal and middle domain superfamily	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48083 all species →	MEDIUM-CHAIN SPECIFIC ACYL-COA DEHYDROGENASE, MITOCHONDRIAL-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016627 all species →	Molecular Function	oxidoreductase activity, acting on the CH-CH group of donors	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0003995 all species →	Molecular Function	acyl-CoA dehydrogenase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0033539 all species →	Biological Process	fatty acid beta-oxidation using acyl-CoA dehydrogenase	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11729	ACAD10; acyl-CoA dehydrogenase family member 10	-	Lipid metabolism	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030064-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

43.4Max TPM

12.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.75	15.02
polyp at pH7 6	18	18	13.63	18.21
coral polyp · control treatment	16	16	13.15	28.59
coral polyp · oil and dispersant treatment	16	16	10.70	22.89
coral polyp · oil treatment	16	16	13.74	34.67
coral polyp · dispersant treatment	16	16	9.03	23.71
Polyp	10	10	12.11	43.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.02
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.50
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.75
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.22
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.66
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.53
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.37
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.09
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.75
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.58
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.53
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.84
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.34
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.71
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.39
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.57
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.28
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.15
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.13
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.54
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.52
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.18
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.59
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.32
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.96
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.96
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.90
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.76
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.52
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.18
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.50
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.89
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.09
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.01
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.99
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.40
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.51
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.88
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.67
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.03
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.48
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.01
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.24
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.64
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.71
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.23
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.14
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.86
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.74
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.54
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.49
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.93
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	43.40
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	15.06
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.18
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.07
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.01
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.21
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.50

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.