Gene detail

Detailed information of OS493_030229-T1 in Lophelia pertusa

Genomic Location: scaffold_192:235872...281316
NR annotation: KAJ7324056.1, Dedicator of cytokinesis protein 9 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030229-T1

ATGTCTGAGAGAAAAATAAGCAAAGCTCTCAGAAAGGATCGTGAATCTACAGTATCTGCAGTGGATATCAAGTCCCTTACATCCAGTGAAAGCACCTTTAGTTTAAGACCTTTGAAGGAGGTCGTCACTGGCATTTTACCCATCAGCTATGAAGACGAAATCGTGCAAAAACGAACACAGATATTGCGGGATCCTTTGCAGATTTTGTTGGTGTTTCCAGAGGACGATGTAATCGCTTTTGCTATTCCTCGCCAACTGAGGACGATACATTCTACAGTGCCGGGCGATGCTCTCTCCAGAGTATCAAACTTATTTACGCGAGAGTGTATCAGATTTTACACTGCCAATTGGAGCTGTATTGAAAACAAATATTCCAGCTATGGAGGCAGTTACCTCAAGCTTCCTAGACCATCTCCAGGAGAGGGACTTGAACCACAGGTTTTTGAGATGGATTGTGAAGAGGAGGTGGACTGTGGAAATCAGACAGTACTGATGAGCCCTTTACGAGAGAAAGGCATTTCCAAACAGGGCTACCTTACAAAGGCTCCATTTCATGGTGAAAGTAATGGTACACCGGGAGCAAAGAACTTCAAGCGCAGGTGGTTTCATCTGAAGCAGACATCAAACGATGGCTCTTACGTTTTAGAGTACAAAAAAGATGACGTCAACACAAGTATGGCCAGAGGAGTTCTGTATTTGGATGCATGTACTCACATCACTAAGGGTGTAAAAGGACGAATGTACGGCTTTGAGCTTCACGTCCAAGACAAACTCTACAGCTTGATCGCTGACAGTCAGTCAGACATGGACGCTTGGATTACGTCTCTGTGCAAAGTAACTGGAATCGATATGGACTCAGGAGGCAAAAGCAGCGGCTTCAACTTGATAGGCAAAATAAAAGGGCCAAAACTCCATCAGTCTCTGAGAGAAAGTCTTAAGAGCAGTAAACATCCAGAACTTCTTGAATTCGCGAAAGAAACCGAAGTTTTGAACGCGAAGCGAAGGAAGGATAGACGAAAAAAACTTTTCTCGCTCGTGCACGACTTGGACAACAACGGTACATGCGTGAACTACGACGATGCGAGAATAGACGCTGATGTATTCCAGCCACATTTTGGAATGCGTCTTGTTCTTGAGTGCGAGGATCTGAAGTTTCGACTGCTAAGAAATTTGCATGACGGCAGCGAAGTGAACATTGAACCGTTCTTTTTGTCGATTTCGTTGTTTGACTCTAAAGAAGGAGCGAAGATTTCGGAGGATTTCCACTGCGATCTCAACGATCCGACCACGGTGGACATGCTCAGAGGCTCAGAACTCATAGAGAATGGTCAAGCGAATGGGAATGGTGTAGATCACACGGAGCTTGATAGTCGGGAGTTGGAATACACTTCTCCAAGAAAGGCAATATTCTCTATAACTAATGCCCACCCAGAGGTCTACTTGGTGGTCAGAATAGAGAAAGTTTTACAAGGAAGCATAGGTTCATGTGTTGAACCGTACCTCAAGTCCGTGACACGAAAAAAGCTGCACAAAAGGCACACAAACTGGCCGAGATCTGCTGCAAGAGCCTGGGGCAGTATGGGATGCCGTTTGCCTGGACAGCCAGTGCATGGCAATAAACCGTTGTTCAACAGTGAAGGCGAATTTGAAAGCGGCGAGATTACTTCAATCTACAAACAGGACAGAGAAAAGCTCAGTGATGAGGAGATGATTAAACTCTTGTCAAACTACAGTGCTACAAAGGAAAGATTCAAACAACAGCTTATACCAGGAACCTTACACATTTCTGTCAAGAAATACGTTGAAGGAATACCAAATTGCATGACGTCATCGCTCGTTCCCGTCAAGCCTTGGGATGATTCACTGACCGTTCGTCCAACAGTGGAAGTGGATGAATTCTGTCAATCATGCCCAGAAGCTGCCCAACCACACACTTCCTACGTCAAACACCTCTACGTCTACCCTCTTGCACTCAATTATAGCAATCAAAAAGTTTTCTCCAAGGCAAGAAACATTTCTGTTAAGATCGAATTCAGGGATTCTGATGATGAAAATGCAAAGCCTCTCAAGTGTATATACAAGAAGAAAGGAAGCCGTGGTTTCACGACACACGCATACGCCGCCGTTGTTCATCATTGCACAAATCCCACATTTTACGAAGAGGTAAAAATCAATCTTCCCACTCAACTAACAGACAAGCATCACGTGTTCTTCACATTCCAACACATCGCGTGCGAACAGACCAAGAGTAGTAGTGGCACGGGATCAGTCAAGACCACCGGCCCTGAGTTGAAATGGGTGGACAGAGAGAAGCCGCTGTTTAAAGTGTGCACCAAACTGGTTTCCACTGTCAACACTCAGGATCCTGAAGTGGACAACTTTTTCCGTCATTGTCAGAGATTTGACGGGTCTCCTGCTACTGACATTGAAATGGTCAAGCTGTTAAAGGTCCTCAATGCGGTAAATGTTGGCACCGTGGCTAGGTTCCTGCCCGTCATCTTCAATCAACTCTTTCATATTCTCGTTGTCACTGGAAACGAGGACGTCTCACTGAACGTGGTCAGGGTGTTGATTCGCATTACGGCGCAACTTCACGGGGCTAGCCGACTTGAAGCTTTGAAATCTTACGTCAAGTACGTGTTCATCACTGAACAAGCTTTGGACAACAACAAGACGATTCACGAACAGCTTTCAAAATACCTGATGACAAGTCTGAAGCCTGGTGCTGATCCAGTGCTGGTCAACGAACTTATGACGCTCTCCTGGTTTTTCTTTGAGATCATTGTGAAAAGCATGGCGCAGACGCTCGTTCAATCGGACAAGTTAAAGGATGCAAATTTTCATTTGGCTTGCTTCACCAAGGACTGTTTCACATACTTGGACCGTGGATTTGTCTTTCAAATGATCAGTTATTATTCTGAGCAGTTTAAAGACTCTGATACACAGATGCTGGAATTCAAATTCGAGTTTCTTCAAGTTGTCTGTAATCACGAGCATTACATTCCACTTAATCTGCCTTTGGACGTCAGAACTCTCGGTGGTGTCCACGACTGTGAGCTGACAGATGATTACTGCAAGAGATATTTCCTCGTGGGACTGCTACTGCGAGAGGTCTCTTCCGCTCTTACACAGGGCCGGCACATTAGAAAGTTAGCTATCAGAGTGTTGAGAAACATGCTGGTTAAACATGAACTTGATGACCGCTATGAAGGAGAACAAAAGCAAGCTCGCATCTGCACCTTATACCTTCCCCTTCTCTCGGTCCTCCTGGATCACGCACCTCGTTTCCATGGCAGCAAGTACGACCTGTCGAACCCAGTCTTCGCGCAGCAAATGTCCCAGACCTCCTCCACCATGAATGTCCCTAACAGTGAATTTGGCGTGGATTCTAACCGCAGCTCAAGTTACTCTGCAGTAATGAAGCAAAGTCCCAGTGATTCACTGACGCCCCAGACAGCTGCGCCACTCAGGGAGGCTACCCAGATTGCTTTGCAAGTACCGTTGGATGAAGACGAGACAAAAGAGCTGCTCCTGTGTGCGTTGTACATCTTCAAGAATCTAGAGCAAGGTGTGATCCTGGATTGGTGGAGACAGATCCTGTCATCTTCAATTAAACGTCCTCACTGGCATCCAACAGTTCTGTATTTAATACAGCAGGACAAAAATTACAGCAAGTTTGCTGCAATTATTGATGTGTTTGATTTGCTCGAACTTGCTTTGACGCACTTTCAATTCGTTGGACAAGAAAAATTGCATCCCAAAGGTATCAATCTGGACATTCAAACTCGTATCTTAATGGAAGGAAATCTCGGGAATGAAGTCGGTCTTGTCGTGTTAGACACCATTGAGCTATTTTGTGGCCATTTTAAGTTTCACCTGGAACAAGATGAAGGTGACAATCTACTGATGAAGAAGGTGTTCAACGTACTGTTAAGCTTCCTACAGATTCCTCAGTCAGAGTTCATGATGAGACACGTGTTTGCGAGCCTGCGATCCTACATTAACAAGTTTCCTGCTGCATTATACAAGGGCAGTGCGAGTTACTGCGGAGATCTTTGTCGTGAGATTCTCAGCTGCTGCAACTCGAAGTTGGAAAGTCTTCGGAACCAGGCTTGCTCGTTTCTTTATCTGTTGATGAGAAGTAATTTTGAATTCACTGGAGCACAAGGCTGTGATCGAGTGCACTGGCAGGTTATCGTGGCGGTCTCTAAGCTGATGGCGAATGGTTTAAACCGCGCGGCAGTCAACAACTCTCTTCTGGCGCTGAAGAATTATGCTGTCGAGGATAAAGGAATGAAGCACTCGGCGTTTCCTTCTGAAGTGAAAGATCTAACGAAGAAGATTCACACTGTTTTACAGGCGACTGCGCAAATGAAGGTACGTGTCTACTGTTTGTTTGTTGGATTGTTTTCTAAACAACACTTTAAAATCGTTTAA

Transcript

OS493_030229-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2AF47	Dedicator of cytokinesis protein 11 OS=Mus musculus OX=10090 GN=Dock11 PE=1 SV=1
Q9BZ29	Dedicator of cytokinesis protein 9 OS=Homo sapiens OX=9606 GN=DOCK9 PE=1 SV=2
Q5JSL3	Dedicator of cytokinesis protein 11 OS=Homo sapiens OX=9606 GN=DOCK11 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000675 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14429 all species →	DOCK-C2	C2 domain in Dock180 and Zizimin proteins	Domain	Interproscan
PF11878 all species →	DOCK_C-D_N	Dedicator of cytokinesis C/D, N terminal	Domain	Interproscan
PF00169 all species →	PH	PH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR027007 all species →	Domain	C2 DOCK-type domain	Interproscan
IPR026791 all species →	Family	Dedicator of cytokinesis	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR021816 all species →	Domain	Dedicator of cytokinesis C/D, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23317 all species →	DEDICATOR OF CYTOKINESIS DOCK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0043547 all species →	Biological Process	positive regulation of GTPase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K21853	DOCK9_10_11; dedicator of cytokinesis protein 9/10/11	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030229-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

37.7Max TPM

14.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.18	19.60
polyp at pH7 6	18	17	11.75	21.48
coral polyp · control treatment	16	16	20.26	37.66
coral polyp · oil and dispersant treatment	16	16	16.67	30.32
coral polyp · oil treatment	16	16	16.34	33.65
coral polyp · dispersant treatment	16	16	16.78	26.39
Polyp	10	10	3.51	6.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.60
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.05
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.61
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.39
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.27
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.92
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.19
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.09
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.34
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.20
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.46
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.35
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.50
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.05
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.06
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.78
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.25
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.55
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.65
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.40
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.66
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.59
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.69
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.59
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.92
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.17
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.87
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.97
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.43
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.42
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.32
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.83
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.76
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.41
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.17
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.30
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.50
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.65
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.80
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.71
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.90
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.77
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.22
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.88
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.99
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.89
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.86
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.16
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.28
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.19
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.60
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.13
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.61
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.57
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.23
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.97
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.14

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.