Gene detail

Detailed information of OS493_030307-T1 in Lophelia pertusa

Genomic Location: scaffold_194:230189...243486
NR annotation: KAJ7383155.1, hypothetical protein OS493_030307 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030307-T1

ATGGACAGCGTAAGGTATTTGTCCTATCACCAATGGAAGGACAGTAAAGGCGACACAAGCAAATCACCTACGTACCATCAGAAGCTTCTGGCGAACGTCGAAACACTAGACACAAACGTAGGGGCGATCGACAAGTTGATAACTGGTTATTTAGATGCCACAAAATCTTTCTGCGGGGCAGGTTCCCAGCTGGCAGAATCCTTTTCGACGGTTTTAAAAGAAACCCCGCTCCTCGAAATCTCGCAACAGCTGAAGCAAGTTGTGGAAGAAATCGACCATGTCGCTCACAAGTCGAGTGTTCATATCACGAGTCATATTTTGGGAACGCTTTGCGAGTTCACGGCGACTTTGCCGGGGCTTAGACGAGCCATCGAAGCGCACAAGAGAAGCGTTCAAAACTACGAATCGTGTCAGGAGAACCTTGAATTGTTAGAGAAGGACGACAGCTTAGTAAACAATGATGGCAAACGACTCAAAACAACCAGACAACGATTTCGCGCGGCGACTGAGGAACTCACGACAGAAGAAGAGAAATTGTACAGAAGCTTTTCCGAAGTGGAGGAAAATAGAGTCAAGATGTTGGGTTCTTGCTTCCTCTCACTGTTACAAGTCCAGTCACAGTTTTTGATGTCATCAGCTGACTTGACGGCATCACTTGGTGGCTTCCATGAGATTGGTGACTATCTGCGGGACAGAGAGGTTACCCTGGCACTCAAGGATGCCACGGCGACATGGCTGTCACTTGCTCAAACGAACCAATCTTTGCGTCAGGGAGAGGTATTGTCACGGCAACAGGTGCAGTTCTTAACTTTGGGTGGTCAGGGGGAACTGGCCGATCCAGAACGGAAGGAGTTAATACTAAAAGTCAATAATTTGCTGAAGAATTACAAAAAAGTGTTTGATCGAGCACCAACACCAGAAGCAGACATACCAGCTGGCTTCCACAAGAATCCCAGAGGAATAGAGCTGGCTCTAAAGGGATGCTGTAGTAAGCTGGAGGCTATGGCTGCTGGAGGTGTCACAGAAGCTGTGACTGTTCAGGAAATGGAGCAACAGATCCTGAAGCAGATTCCCAAATTACAATTAAAAATTGGTTATGTGATGACTGAAGTGTGCTCTTCTCCAAGTAAAGCCAATGACAACTACAAATCTAAACTGCACTGTATCAGAGACCTTGCTAGCTCTGTTGCCAAGCAGAATGACATCCCCCTTAACCGCGAGACCCTGGATATGTTTGTACTGATGGTGTTGTATGAGGCTTGTTCTCCAGTTTCCAGCTCTGCTGCCAAGACTGCTGTGCAGCTTCTGTTTGGCAGAGCACATCTGGTGACAGCCAAACCAAGCAAAGATAAAAACACTCGGCTGGCCCAAGTGTATGTAAAAGGAACATCCATTCATGTCGAGGTCTCCACCACATGGGTCATCACAGAAGATGCTTCCACATTTGCTTGTCTGTTAAAAGACCTGGACTTTGCTTCTCCTTTGGGAACAGTTGATGCTGTTTATACATCCAAGTTTAGTTTGATGGACTATCTGGAGGACAAGAAGTCGGTAGCATCCAAGACGGTCAATAATGTCAATACGGTAGTTGATCCAACAAATCCGAATGCTGTATCTGGTGCAGGCACTAGACATGAATCAGCAGGTAATCGAACATCAGTAGCCTCTAGTACTGACACTGAACATGACACAGACATTGATGACCCAACTCCCCTACCCCCGCCACGTCCACGACACTGGGCTAGGAGGGCTAAAGAACAGTCTATGGTTCCTGAAAGTAACAGCTTTAACTCAGGAAAGATTGCTGAAGAGGAAAGCAAGGCTGATGATCCCTCATCACCAAGTGATTGGTCGAAGTCTGTTCCACAGTTTCCATTGCTGACTTTAAAACCGACTTGTATGCAAAATTCTCAAAGTGAATTGTCACTAGCTTCGCAAGAAGAACTCACAGAAGTCATCAACTTTCTTTCTGGTGCACCAATCAAACTTCGACTTCTAAGTGATGACGACACCAATCCCAGCATGGCAGAAAGTCACATGACACCTGTGGATAGTGGCCTGGGTAGTATCTTCAGTATGGCCTTGAGCAACATTACTCAGCCTAGCTCAGCACCCACGTGTGCGTGTGAAAAAATTGACAACAAAGAATCCCATGAGGTGACACCATTCCGTAACCAATCAGAAAGCAAGGAAAGGGCTACAACTCCTGATGTGTATTCAATTAAGGGTGCAATGGCAATGGTTACCATGGAGACACAAACCTCTCCTTCAGCTGAACTGTGTCCAGTTTTGTTGGTTAAATCTGCAGATTCCGACAGCGAGGAACAATGTGGGCATCAGTCACCAGCAGAGAACGATGAACAACAAAACCAACCATCAAACAAGGAGGAAGAAAATGACGACAGGATTCCAAGCCCTAGTGGCACTCCTCGACCAGTGTCACCATCACAAACAAAGCAAGATACCACTGATGTACATGCTGAAAGTCCAGACAGTGTACCCAATGCTGAGACACCCAAGTTGAGTGTTGAAAACGAGGAACAAACTAAATCAAGCAAGGCGCCCAGCCCTGTCTTTGTGACAGTCAGCTCAGAAGAGTGTGACGACGACAAAACATTGTCCATCAGTGAGAGCCTTAGGAGTGTATGGGAGAAAGTCAGCCCTCCATCAGATTGCTCTGATACTGTCAGCACCAATCCTGAGGGTGCACAGCTTTGCAAGAAAGATATCCACGGCTCGCAGGACACTCTCTATCACAGCTGCTGGTCCCTGTCTGATTTCTCCGGCAACGATAAGAGCGACGAGAGCAATGAGGATGCTAAGAGTCTCAATGAGAGTTTGCTGCCGAGTAACTCTGGTCCAGGTCTGCTGGATCTTGGTTTGAAGTGGTCAACTTATGGAAGCAGTATCCATGGCAACCCAGTCTGGGCCAACATTCCCAGTGCTTCTGGTAGCAGCTGGAATCAGTCCCAGGAAGTGTTGAGCACGGACAGGTCCGGAAGAGGGAAGACTGTGTTCTCACTGGGGTTGGGAATTACTGGACCTGACCTGCTGGCCGCCGCTCGAGGAGGAAGTTGTGAAGTGATGCCCAGTGAAAATATTTCCTTCATGCCAAATGTTGGAAAGCCTTGGAGTACGGAGGACTTGGTGCAAAAGAATCCTTGGTCAACAGGAGATTCTTCCCCACCCCTGTTGTGGGCCAAGACAACATCATTAACAGAAGACACTTTGAGGCCATCTCACCACCGACCCCATCTCCCACCGCAGCACTACAGTGACCCTTTTCTTCCGAGGGAGAACTGGTGGCCACAGGGGAGGGGTGGTGCACCTCCGGGTATCCCCACCCCTCCTATGCACGGTACCATACAAATCTTCAACGTCAGCGTGCTTTTGACAACATGCAATACGGAATGCCGGGAAGCTTACAGAGAGGCCGTGGTACAATGGGCTCACAGTCGGCATTTCAACCGGTTCAAACCGGTTATCGAAAGCAAGGTCAACAAATACAGCAGGCTCGTCTGCAGGTACCTTCGCACTACGCGGCAGGGCATGGGTCCCATCACAACTCAAACCCCCGCTTTTAGTTACAAAAACAGAAGAGATAAGTTGTGTAGTTTTAAGTGA

Transcript

OS493_030307-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006900 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15923 all species →	DUF4745	Domain of unknown function (DUF4745)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027267 all species →	Homologous_superfamily	AH/BAR domain superfamily	Interproscan
IPR031813 all species →	Domain	Domain of unknown function DUF4745	Interproscan
IPR043385 all species →	Family	Granule associated Rac and RHOG effector protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15703 all species →	RIKEN CDNA 4931406P16 GENE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016601 all species →	Biological Process	Rac protein signal transduction	Interproscan
GO:1905762 all species →	Molecular Function	CCR4-NOT complex binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_030307-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030307-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

55.1Max TPM

25.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.95	30.67
polyp at pH7 6	18	18	18.02	26.67
coral polyp · control treatment	16	16	31.71	54.05
coral polyp · oil and dispersant treatment	16	16	34.29	48.79
coral polyp · oil treatment	16	16	25.33	38.23
coral polyp · dispersant treatment	16	16	36.25	55.07
Polyp	10	10	7.17	12.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.67
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.67
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.89
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.69
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.85
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.72
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.57
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.09
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.17
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.04
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.48
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.30
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.21
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.27
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.67
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.14
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.06
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.27
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.81
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.33
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.13
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.61
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.05
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.87
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.59
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.42
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.53
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.50
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.03
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.31
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.08
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.19
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.79
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.52
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.48
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.66
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.52
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.06
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.89
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.67
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.38
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.23
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.43
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.77
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.72
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.93
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.02
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.80
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.83
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.52
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.42
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.51
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.07
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.87
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.51
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.13
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.75
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.09
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.12
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.82
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.10
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.04
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.40
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.23
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.08
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.69
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.90
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.88

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.