Gene detail

Detailed information of OS493_030309-T1 in Lophelia pertusa

Genomic Location: scaffold_194:250119...267879
NR annotation: KAJ7383157.1, Golgi transport complex subunit 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030309-T1

ATGCACAAATCCATCTCCACGAGTCCTAACCTGCAGTTGGTGATGAGAGATGCACAACATTTGCACAGCATGATTTCCAACACCTCAGATTTAGCTGAAAAGGTCAGCAGCAAAGTGCGACTACTGGATCTTGTCAAGAACCGAGTTCAAGAAACAATAAAACGAGTGGATGACATTCTTGATTTAAAGGCCTGTGTGGATGGTGTGCAAACAGCACTAAACACTGAGCACTATGAGCAGGCTGCGGCACATATTCACAGATATCTAAATCTAGATAAAGAGGTCCTCAAGGAGATTACAGGAGATTCAAAAGAAGGCTCTGATTTAGCAGGAGCGTTTGTGTTACTCCATGAAGCAGAGAAACAACTGAAAAGAATAGTTCATGACAAGTTTGAAGCTGCCATACAGAATGGTGACAGAAACTCTGTTGAAAGGTTTTTCAAGATTTTTCCATTACTTGGTCAGCATGACATTGGACTGGAAAAGTATGCAAGATACCTGTGCTCTCAGATTGCTGCTCAATGCCAGAAGAATCTTGACAGTGCTGTCGCTACCAAGGAATCAGATCGTCTTGCTAATGTCGTGTTTGCCAACACCTTGACCTTGCTGTTTGAGAACATTGCACGCATGGTGGAAGAACATCAGCCATTTGTAGAGACTTACTATGGTCCAGGTAAAATGTTTATTCTACTGCAAGCTATGCAGGCTGAGTGTGACAAACAAGTTAATCAAGTAGTGGACCAGTTTATCAAAAAGAGACAGTTCAAAGAAAAGTTTAAGTCAGTGCAGGGCAGTCAAACATTCAAAGGATCTTCTGCTAATATTGAGAGATATGACCCAAGAGAGCTTGATGTTGTTTTACGGGAAGTTGTAGTTATGAATGCCAGGGCAGAGATGTATTTGCGGTTTGTTGAAAAAAGGATTGCTGATGATATGGAAAATGTACCAGAAGAGGAAATGACTGAAGAACTGTTAGGAATTCAAGATAAAGTGATATCTAACTGTGAACTAAACAGAAGAATGCAGGAGCTGATTGGAAACTACATTTACATGGAAGAGTATTTTATGAGAGAGACTGTTATGAAGGCTGTGAAGATGGATATTTCAGAAGGTGGTGACGATGAAGCTGTCACATCCAGTATGGTAGATGATGTCTTCTTTATTGTACAGAAGGCAGTACGACGTGCCCTATCCAGTTCTAGTGTGGATGGAACATGTGCAATGCTAAATCATGCTTGTGCTCTTCTGTCATCTGATTACCGCGATGTGCTAACCTCCAGGTTAAAAGCTGGTTTTCCATCTGGCAGTCTCGATTTATCTGGAATGTTACAAGGGAAGATACAAGTGGGTTACTCCACAACTGCTGAGAATGCAGCTGCCAGGAAGGCTTTCCTTGTGACACTCAACAATCTTGAAGTTAGCAGCAATAACATTCAGAAACTGAAGAAAGATCTTGAGATTGAATGTGAAAGGAACCTTGCTTTCGGAGAACCTGCCAAACTTAAATTAGAGAGCTGTTTAGCAGACTTGATGAGCACGTCAAATATCTTCAAGGATCTACTTCAAGGTGGAATATATCAACTGTGCTCTACTGCTGTGATACCAAGATTAAAACCTCTAATCGACGGATTCAACTCAACAAGTCACAACATATCTGAGGAAGAATTTGCCTTTTATGAAGTCAACGATCCATTTGTTCAGAATTTCATCACAAATTTGGACTCGATGCTGACATCCTTTAAGGGTCCATTGACACCAACCAACTACGATTCTTTAGTAAGTATGGCCACCACGGAGATAACAACTCAATTGGAGACCTCGGTCATGGAAGCGTTCTTTAACAGGCTGGGTGGACTTCAGTTCGACAAGGAGCTGCGTTCATTGGTTGGTTATCTGACAGCTGTCACTCAATGGACAATACGAGACAAGTTTGCAAGGCTTACGCAGATTGCCACTGTTCTTAATTTAGAGAAGGTTGGCGAGATCATGGATTACTGGGGCGCCAACTCAGGGCCCATGACATGGAGACTTACTCCAACTGAAGTCAGACAAGTGTTATCATTGAGGGTCGATTTTAGAAGTGAAGATATCAACCGGTTGAAGCTCTAG

Transcript

OS493_030309-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3MHG0	Conserved oligomeric Golgi complex subunit 4 OS=Bos taurus OX=9913 GN=COG4 PE=2 SV=1
Q5R7R6	Conserved oligomeric Golgi complex subunit 4 OS=Pongo abelii OX=9601 GN=COG4 PE=2 SV=1
Q9H9E3	Conserved oligomeric Golgi complex subunit 4 OS=Homo sapiens OX=9606 GN=COG4 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003268 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20662 all species →	COG4_C	Conserved oligomeric Golgi complex subunit 4, C-terminal	Repeat	Interproscan
PF08318 all species →	COG4_m	COG4 transport protein, middle alpha-helical bundle	Repeat	Interproscan
PF20663 all species →	COG4_N	Conserved oligomeric Golgi complex subunit 4, N-terminal	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR048684 all species →	Domain	Conserved oligomeric Golgi complex subunit 4, C-terminal	Interproscan
IPR048682 all species →	Family	Conserved oligomeric Golgi complex subunit 4	Interproscan
IPR013167 all species →	Domain	COG4 transport protein, middle alpha-helical bundle	Interproscan
IPR048680 all species →	Domain	Conserved oligomeric Golgi complex subunit 4, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24016 all species →	CONSERVED OLIGOMERIC GOLGI COMPLEX SUBUNIT 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006890 all species →	Biological Process	retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	Interproscan
GO:0007030 all species →	Biological Process	Golgi organization	Interproscan
GO:0017119 all species →	Cellular Component	Golgi transport complex	Interproscan
GO:0048213 all species →	Biological Process	obsolete Golgi vesicle prefusion complex stabilization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20291	COG4, COD1; conserved oligomeric Golgi complex subunit 4	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030309-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

26.9Max TPM

11.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.67	14.05
polyp at pH7 6	18	18	11.45	18.83
coral polyp · control treatment	16	16	15.11	26.93
coral polyp · oil and dispersant treatment	16	16	11.47	21.19
coral polyp · oil treatment	16	16	14.06	26.89
coral polyp · dispersant treatment	16	16	8.68	17.85
Polyp	10	9	10.41	15.06

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.05
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.32
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.31
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.67
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.24
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.14
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.60
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.30
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.28
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.65
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.45
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.23
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.91
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.64
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.83
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.80
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.91
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.80
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.31
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.97
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.98
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.13
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.03
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.41
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.75
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.03
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.39
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.69
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.78
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.46
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.06
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.32
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.33
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.57
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.22
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.88
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.60
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.15
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.44
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.19
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.88
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.39
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.89
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.51
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.67
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.66
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.48
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.28
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.53
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.73
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.34
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.85
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.14
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.65
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.63
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.56
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.26
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.89
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.93
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.72
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.35
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.06
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.21
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.36
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	9.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.27
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.