Gene detail

Detailed information of OS493_030310-T1 in Lophelia pertusa

Genomic Location: scaffold_194:268043...275141
NR annotation: KAJ7383158.1, RNA-binding protein 28 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030310-T1

ATGGCGGAAGATAGCACCGAGAAGAGTAAATCGGAAGATCGTTCCGTAGTTTCTCAAAAGGTGCTTTTTGTGCGCAATCTACCATTTACAACGACAGATCAAGATCTAGAAAATGTATTCAGTGAGGTTGGACCTATCAAGCGTTGTTTTGTCATCCGAGATAAAGGGATAAAGAGTATGTGCCGTGGGTTTGGCTATGTTACATTTGCTCTAGCTGACGATGCACAAAGAGCTATAGATGTTGTGAAAACATTTGGGGGACGGCAGCTGAATATATGTTTTGCTGACAAGAAACCCAAACATGAAAAGAGGAAAATGAAGCAGAGCTCAGGAAATGCAGATGTTGGTGATGCAGACATTGGTGATGATGACAATCTAAATACCAAAGACAAGGAAGTCAAAGAAATGTCCGCTGATGAAGAAGAAGAAATGCCACCAAAAAAGAAGTTAAAAAGCAACGAACAAGAGGAAAAGGCCAAGTCTCAGAAGAGAGCAACGGGAAAGGATATTGGCAGAACTATTGTACTAACAAAACTCGCCCAAGATCTCAATCAAAACCACGTCAGGAAAAAGTGTCGAAAGATTGGGCCAGTAGAAAAGGTTATATTCCCGGTGGAGGGCAGAGATTCGCCAACTGCATTTGTCATTTTTCAGTCCCACAAAGATGCAAGAGAGGCTGTAAAGAAATTGAATGGCAAGATTTTTAAAGGGAACTTCATTGAAGCCTCTCTTCTTTCCAGAGAAGGGAAGACACAGAATCAGAAATCCATTAAAAAATCCAAGCTTATCGTCAGAAACTTGTCATTCAAGTGCAAAGAGGAGGACATCAGGAAATTTTTCTCGCAGTTTGGACAGATCACTGAAGTGCACATTCCAATCAAGTTGGAAGGCAAGCGGAAACGCAGTCTTGGTTTTGGCTTTGTGCAGTTTTCCAGCGTGTTTGAGGCTGCAAAGGCCGTCAAAGAGGCAAACATGAAGGAGATAGCTGGTAGGCCTGTGGCTGTTGACTGGGCTCTGTCCAAAACTATTTACGAGACGAAAAAAGGCCATGAAGAGGAAACTGATGAGAAAGAGAAAAGTGAACATGAAGACAAAGGCGAGAAAAAATTACACAAGGATGAAGAAGATGCTGATGATGTTTCCGGCAGTGACTCTGATGTTGAACCGAGTGAAAGAAAACTCGGCAATTCTGATAGTGAAGATGAAGAGGAAGGGCAAAATGAGAACAGCGATGAAGAACTCAATCGCAAAGAGACCCTACAGACAAAGAATCTTAAACAATCATCTGACGTGAAAGAAGGCAAGACCCTGTTTATCCGCAACATTTCATTTGACTCAAGCGAGGAGTCACTTCACGAGCTCTTTGAACAGTATGGCGAGTTAGACTACTGCAAGATATTGGAGGACAAGCGAACGGGTCACAGTCGAGGAATGGCATTCGTGAAGTACAAAACAGTGGAAAGTGCTGAGCAGTGCCTTACGGAAGCTAGCAAGGAGGGTTCAGCATTTTCCCTGGATAATTTTACACTGAACGTGACAAAAGCAGTAACACGTGGAAAGGCAGCAGAACTAGCCAAGGAAAGGAAGATGGAAGGGAACAGGGGGGAGAGCAAAGACAAACGCAATTTGTACCTGGCGAAAGAAGGTCTTGTCATGCCAGGCTCAGAAGCCGCTCAGGATTTGTCAAAAGCTGATTTACTGAAGAGGCAGAAGGCTGAAGCGGAGAAGAAAGCGAAGCTAGAAAATCCGAACTACTTTGTCTCAACGACCAGGCTTTGTGTGCGAAACCTTGCTCTAAACATTGACGATAAACAACTGCAAGAAATCTTCAGCAACGCTACCGGGAGAAGAGCGCATGTGCAGAAAGTGTTGGTCATCCGAAGTAAAGATCGAATGGACAGCTCGGGCCGCGGGCGCTCCATGGGATACGGGTTCGTGGAATTCGCCAATCACAAGGACGCTCTGGCAGCCCTGCGAGCGACCAATAACAATCCAGCGTTATTTGGCGCGGACCGTCGGCCGATTGTGGAGTTTTCTTTGGAGAACAGCCTCGTTCTCAAAACGAAGCAGCGACGGTTTGACAAGGCTCAATATAAGCAGCAGCAGCAGGGCGTGGAAGAGCATGCGCGCGATGGCCAGCCTATGACAAACAAGGAGAGAAGACTGGAGAGGAATCAGAAGCGAAAGGAAGCGCGACAGAGAAAGAGAGACGCGAAAAAGATCAGAAAACTGGAACAACCAAAGGAAGGTGAAGGCGCTAAAAAATCCGAACAAAGCGACGAAACGAGAAAGGCAGAGAAAAGGGCAAGTGTAAAGTCACCGAAAGTGAAGACAGGAAATTTTCCATCGAGAACGGACTCTGGGAAGCTTGATAAAAATAATCAACAAAAAAGGGACCATTTTCTTTTCCCGCAAACATGA

Transcript

OS493_030310-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CGC6	RNA-binding protein 28 OS=Mus musculus OX=10090 GN=Rbm28 PE=1 SV=4
Q9NW13	RNA-binding protein 28 OS=Homo sapiens OX=9606 GN=RBM28 PE=1 SV=3
O74400	Uncharacterized RNA-binding protein C4F6.14 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPBC4F6.14 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005182 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR051945 all species →	Family	RRM MRD1 RNA Processing and Ribosome Biogenesis	Interproscan
IPR003954 all species →	Domain	RNA recognition motif domain, eukaryote	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48039 all species →	RNA-BINDING MOTIF PROTEIN 14B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14573	NOP4, RBM28; nucleolar protein 4	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030310-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

9.0Max TPM

3.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.77	4.72
polyp at pH7 6	18	18	3.26	5.31
coral polyp · control treatment	16	16	4.48	8.83
coral polyp · oil and dispersant treatment	16	16	3.58	8.27
coral polyp · oil treatment	16	16	3.72	8.99
coral polyp · dispersant treatment	16	16	2.67	6.08
Polyp	10	9	1.78	4.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.16
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.55
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.39
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.23
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.19
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.84
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.81
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.74
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.61
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.31
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.09
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.40
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.13
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.20
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.84
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.80
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.62
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.76
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.61
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.57
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.35
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.33
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.79
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.73
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.49
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.33
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.95
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.79
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.48
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.32
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.12
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.35
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.99
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.47
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.98
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.28
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.69
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.59
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.43
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.38
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.17
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.85
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.08
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.74
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.65
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.85
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.58
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.83
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.01
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.18
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.34
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.23
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.08
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.